Construct: ORF TRCN0000474603
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005680.1_s317c1
- Derived from:
- ccsbBroadEn_02353
- DNA Barcode:
- TCACTGCTACCTACCGGCTAGGGG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MPZL2 (10205)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474603
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10205 | MPZL2 | myelin protein zero like 2 | NM_005797.4 | 100% | 100% | |
| 2 | human | 10205 | MPZL2 | myelin protein zero like 2 | NM_144765.2 | 100% | 100% | |
| 3 | mouse | 14012 | Mpzl2 | myelin protein zero-like 2 | NM_007962.4 | 84.6% | 81.3% | (many diffs) |
| 4 | mouse | 14012 | Mpzl2 | myelin protein zero-like 2 | XM_006509999.2 | 84.6% | 81.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 711
- ORF length:
- 645
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgta tggcaagagc tctactcgtg cggtgcttct tctccttggc atacagctca 121 cagctctttg gcctatagca gctgtggaaa tttatacctc ccgggtgctg gaggctgtta 181 atgggacaga tgctcggtta aaatgcactt tctccagctt tgcccctgtg ggtgatgctc 241 taacagtgac ctggaatttt cgtcctctag acgggggacc tgagcagttt gtattctact 301 accacataga tcccttccaa cccatgagtg ggcggtttaa ggaccgggtg tcttgggatg 361 ggaatccTGA GCGGTACGAT GCCTCCATCC TTCTCTGGAA ACTGCAGTTC GACGACAATG 421 GGACATACAC CTGCCAGGTG AAGAACCCAC CTGATGTTGA TGGGGTGATA GGGGAGATCC 481 GGCTCAGCGT CGTGCACACT GTACGCTTCT CTGAGATCCA CTTCCTGGCT CTGGCCATTG 541 GCTCTGCCTG TGCACTGATG ATCATAATAG TAATTGTAGT GGTCCTCTTC CAGCATTACC 601 GGAAAAAGCG ATGGGCCGAA AGAGCTCATA AAGTGGTGGA GATAAAATCA AAAGAAGAGG 661 AAAGGCTCAA CCAAGAGAAA AAGGTCTCTG TTTATTTAGA AGACACAGAC TACCCAACTT 721 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 781 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 841 CTTGTGGAAA GGACGATCAC TGCTACCTAC CGGCTAGGGG ACGCGTTAAG TCgacaatca 901 acctctggat tacaaaattt gtgaaagatt