Transcript: Mouse XM_006509999.2

PREDICTED: Mus musculus myelin protein zero-like 2 (Mpzl2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mpzl2 (14012)
Length:
3474
CDS:
671..1318

Additional Resources:

NCBI RefSeq record:
XM_006509999.2
NBCI Gene record:
Mpzl2 (14012)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509999.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109429 CAGGTGAAGAATCCACCTGAT pLKO.1 1040 CDS 100% 0.405 0.324 N Mpzl2 n/a
2 TRCN0000109426 CGGGACAGATGTTCGGTTAAA pLKO.1 787 CDS 100% 13.200 9.240 N Mpzl2 n/a
3 TRCN0000109425 GCGCAAATCTAAGCACAATAA pLKO.1 2072 3UTR 100% 13.200 9.240 N Mpzl2 n/a
4 TRCN0000109427 GCTAACTGTGACGTGGAATTT pLKO.1 844 CDS 100% 13.200 9.240 N Mpzl2 n/a
5 TRCN0000109428 GCGCTAACTGTGACGTGGAAT pLKO.1 842 CDS 100% 4.950 3.465 N Mpzl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509999.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02353 pDONR223 100% 84.6% 81.3% None (many diffs) n/a
2 ccsbBroad304_02353 pLX_304 0% 84.6% 81.3% V5 (many diffs) n/a
3 TRCN0000474603 TCACTGCTACCTACCGGCTAGGGG pLX_317 53.2% 84.6% 81.3% V5 (many diffs) n/a
4 TRCN0000488678 TAGGTCCTACAGGCGCCTTCAACT pLX_317 52.9% 84.6% 81.3% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489046 CGCCTGTCTTGGATCTTGACTATC pLX_317 49.1% 84.5% 81% V5 (many diffs) n/a
Download CSV