Transcript: Human NM_144765.2

Homo sapiens myelin protein zero like 2 (MPZL2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
MPZL2 (10205)
Length:
1396
CDS:
384..1031

Additional Resources:

NCBI RefSeq record:
NM_144765.2
NBCI Gene record:
MPZL2 (10205)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_144765.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154821 GTTCGACGACAATGGGACATA pLKO.1 725 CDS 100% 4.950 6.930 N MPZL2 n/a
2 TRCN0000155159 GAAACTGCAGTTCGACGACAA pLKO.1 716 CDS 100% 4.050 5.670 N MPZL2 n/a
3 TRCN0000424829 ACCCATGAGTGGGCGGTTTAA pLKO_005 638 CDS 100% 13.200 10.560 N MPZL2 n/a
4 TRCN0000155066 GCATACAGCTCACAGCTCTTT pLKO.1 427 CDS 100% 4.950 3.465 N MPZL2 n/a
5 TRCN0000155014 GAAGAGGAAAGGCTCAACCAA pLKO.1 972 CDS 100% 3.000 2.100 N MPZL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144765.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02353 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02353 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474603 TCACTGCTACCTACCGGCTAGGGG pLX_317 53.2% 100% 100% V5 n/a
4 TRCN0000488678 TAGGTCCTACAGGCGCCTTCAACT pLX_317 52.9% 100% 100% V5 (not translated due to prior stop codon) n/a
5 TRCN0000489046 CGCCTGTCTTGGATCTTGACTATC pLX_317 49.1% 99.8% 99.5% V5 645_646insG n/a
Download CSV