Construct: ORF TRCN0000474822
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015311.1_s317c1
- Derived from:
- ccsbBroadEn_12888
- DNA Barcode:
- TTGTTCCGAATCTTTTCAAAGGGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CORO6 (84940)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474822
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 84940 | CORO6 | coronin 6 | NM_001351301.1 | 100% | 100% | |
| 2 | human | 84940 | CORO6 | coronin 6 | NM_001351302.1 | 100% | 100% | |
| 3 | human | 84940 | CORO6 | coronin 6 | XM_005258056.5 | 100% | 100% | |
| 4 | human | 84940 | CORO6 | coronin 6 | XM_011525390.3 | 99.5% | 99.5% | 591_593delGCA |
| 5 | human | 84940 | CORO6 | coronin 6 | XM_011525391.3 | 99.5% | 99.5% | 591_593delGCA |
| 6 | human | 84940 | CORO6 | coronin 6 | XM_024451010.1 | 99.5% | 99.5% | 591_593delGCA |
| 7 | human | 84940 | CORO6 | coronin 6 | XM_017025235.2 | 53.8% | 49.7% | (many diffs) |
| 8 | human | 84940 | CORO6 | coronin 6 | NM_032854.3 | 49.2% | 45.5% | (many diffs) |
| 9 | human | 84940 | CORO6 | coronin 6 | XM_005258047.4 | 49.2% | 45.5% | (many diffs) |
| 10 | human | 84940 | CORO6 | coronin 6 | XM_024451009.1 | 46.3% | 42.9% | (many diffs) |
| 11 | human | 84940 | CORO6 | coronin 6 | XM_011525387.3 | 46.2% | 42.9% | (many diffs) |
| 12 | human | 84940 | CORO6 | coronin 6 | XM_011525386.3 | 43.2% | 36.1% | (many diffs) |
| 13 | human | 84940 | CORO6 | coronin 6 | XM_011525385.3 | 42.8% | 39.8% | (many diffs) |
| 14 | human | 84940 | CORO6 | coronin 6 | XM_005258048.5 | 42.8% | 39.7% | (many diffs) |
| 15 | human | 84940 | CORO6 | coronin 6 | XR_934579.3 | 26.2% | 1_1022del;1734_2706del | |
| 16 | human | 84940 | CORO6 | coronin 6 | XR_934578.3 | 26% | 1_1044del;1756_2728del | |
| 17 | human | 84940 | CORO6 | coronin 6 | XM_011525388.2 | 24.5% | 18.8% | (many diffs) |
| 18 | human | 84940 | CORO6 | coronin 6 | XR_001752668.1 | 23.1% | 1_1044del;1402_1403insAGTC;1451_1452ins300 | |
| 19 | mouse | 216961 | Coro6 | coronin 6 | NM_139129.1 | 46.8% | 50.1% | (many diffs) |
| 20 | mouse | 216961 | Coro6 | coronin 6 | XM_006532947.2 | 46.8% | 50.1% | (many diffs) |
| 21 | mouse | 216961 | Coro6 | coronin 6 | XM_006532946.1 | 46.7% | 50% | (many diffs) |
| 22 | mouse | 216961 | Coro6 | coronin 6 | NM_139130.2 | 43.2% | 44% | (many diffs) |
| 23 | mouse | 216961 | Coro6 | coronin 6 | XM_006532944.1 | 43.2% | 44% | (many diffs) |
| 24 | mouse | 216961 | Coro6 | coronin 6 | XM_006532937.1 | 43.1% | 43.9% | (many diffs) |
| 25 | mouse | 216961 | Coro6 | coronin 6 | XM_006532939.1 | 43.1% | 43.9% | (many diffs) |
| 26 | mouse | 216961 | Coro6 | coronin 6 | XM_006532940.1 | 43.1% | 43.9% | (many diffs) |
| 27 | mouse | 216961 | Coro6 | coronin 6 | XM_006532941.1 | 43.1% | 43.9% | (many diffs) |
| 28 | mouse | 216961 | Coro6 | coronin 6 | XM_006532942.1 | 43.1% | 43.9% | (many diffs) |
| 29 | mouse | 216961 | Coro6 | coronin 6 | XM_017314461.1 | 43.1% | 43.9% | (many diffs) |
| 30 | mouse | 216961 | Coro6 | coronin 6 | NM_139128.1 | 42.9% | 44.2% | (many diffs) |
| 31 | mouse | 216961 | Coro6 | coronin 6 | XM_006532945.2 | 42.9% | 44.2% | (many diffs) |
| 32 | mouse | 216961 | Coro6 | coronin 6 | XM_006532938.2 | 42.8% | 44.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 777
- ORF length:
- 711
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc gagtccctgg gggtggtttg ctgtgactgc atgcggcgcg cagcggaaca 121 acttcgagga gccagtggca ctgcaggaga tggacacaag caacggggtc ctattgccct 181 tttacgatcc cgactccagc atcgtctacc tgtgtggcaa gggcgacagc agcattcggt 241 actttgagat taccgacgag ccgcctttcg tgcactacct gaacacgttc agcagcaaag 301 agccgcagcg gggcatgggt ttcatgccca aaaggggact ggatgtcagc aagtgtgaga 361 tcgcccggtt ctacaagcta cacgaaagaa agtgtgaacc tatcatcatg actgtgcccc 421 gcaagtcaga cctcttccag gacgatctgt acccGGATAC GCCAGGCCCG GAGCCGGCCC 481 TAGAAGCGGA CGAATGGCTA TCCGGCCAGG ACGCCGAACC CGTGCTCATT TCGCTGAGGG 541 ACGGCTATGT GCCCCCCAAG CACCGCGAGC TCCGGGTCAC GAAGCGCAAC ATCCTGGACG 601 TGCGCCCGCC CTCCGGCCCC CGCCGCAGCC AGTCGGCCAG CGACGCCCCC TTGTCGCAGC 661 ACACCCTGGA GACGCTGCTG GAAGAGATCA AGGCCCTCCG CGAGCGGGTG CAGGCCCAGG 721 AGCAGCGCAT CACGGCTCTG GAGAACATGC TGTGCGAGCT GGTGGACGGC ACGGACTACC 781 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 841 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 901 ATATATCTTG TGGAAAGGAC GATTGTTCCG AATCTTTTCA AAGGGTACGC GTTAAGTCga 961 caatcaacct ctggattaca aaatttgtga aagatt