Transcript: Mouse NM_139129.1

Mus musculus coronin 6 (Coro6), transcript variant C, mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Coro6 (216961)
Length:
1296
CDS:
1..1296

Additional Resources:

NCBI RefSeq record:
NM_139129.1
NBCI Gene record:
Coro6 (216961)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_139129.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425388 ACAAGACCTTGCGCATCATTG pLKO_005 587 CDS 100% 10.800 15.120 N CORO6 n/a
2 TRCN0000437352 ACAAGACCTTGCGCATCATTG pLKO_005 587 CDS 100% 10.800 15.120 N Coro6 n/a
3 TRCN0000435824 TCGGGTCACCAAACGCAACAT pLKO_005 1089 CDS 100% 4.950 6.930 N Coro6 n/a
4 TRCN0000091341 CGAACGAAAGTGTGAACCCAT pLKO.1 900 CDS 100% 2.640 3.696 N Coro6 n/a
5 TRCN0000091339 CGGTACTTTGAAATTACGGAA pLKO.1 754 CDS 100% 2.640 3.696 N Coro6 n/a
6 TRCN0000091340 CCCAAATTTCTAGCCATTATT pLKO.1 130 CDS 100% 15.000 10.500 N Coro6 n/a
7 TRCN0000438243 ACACAAGCAACGGAGTGTTAC pLKO_005 671 CDS 100% 10.800 7.560 N Coro6 n/a
8 TRCN0000091338 CCTGTAAGAAACATCACAGAA pLKO.1 346 CDS 100% 4.950 3.465 N Coro6 n/a
9 TRCN0000091342 CGTGCATTATCTGAACACATT pLKO.1 786 CDS 100% 4.950 3.465 N Coro6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_139129.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12888 pDONR223 100% 46.8% 50.1% None (many diffs) n/a
2 ccsbBroad304_12888 pLX_304 0% 46.8% 50.1% V5 (many diffs) n/a
3 TRCN0000474822 TTGTTCCGAATCTTTTCAAAGGGT pLX_317 45.5% 46.8% 50.1% V5 (many diffs) n/a
Download CSV