Transcript: Human NM_001351301.1

Homo sapiens coronin 6 (CORO6), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
CORO6 (84940)
Length:
1808
CDS:
119..832

Additional Resources:

NCBI RefSeq record:
NM_001351301.1
NBCI Gene record:
CORO6 (84940)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001351301.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108243 GACAGCAGCATTCGGTACTTT pLKO.1 278 CDS 100% 5.625 7.875 N CORO6 n/a
2 TRCN0000108242 TCTACAAGCTACACGAAAGAA pLKO.1 423 CDS 100% 5.625 7.875 N CORO6 n/a
3 TRCN0000108241 CGGCCCTAGAAGCGGACGAAT pLKO.1 528 CDS 100% 0.000 0.000 N CORO6 n/a
4 TRCN0000108240 GCAGGGAAAGTGCTTAGTATT pLKO.1 1144 3UTR 100% 13.200 10.560 N CORO6 n/a
5 TRCN0000446721 ACCTCAAACGGGTGGCGATTT pLKO_005 1200 3UTR 100% 10.800 7.560 N CORO6 n/a
6 TRCN0000108244 CCGGGTCACGAAGCGCAACAT pLKO.1 625 CDS 100% 0.000 0.000 N CORO6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001351301.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12888 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_12888 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474822 TTGTTCCGAATCTTTTCAAAGGGT pLX_317 45.5% 100% 100% V5 n/a
Download CSV