Construct: ORF TRCN0000474925
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003425.1_s317c1
- Derived from:
- ccsbBroadEn_04393
- DNA Barcode:
- GCATGGCCAGGCAATCCAATATCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LCOR (84458)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474925
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 84458 | LCOR | ligand dependent nuclear re... | NM_001170766.2 | 100% | 100% | |
| 2 | human | 84458 | LCOR | ligand dependent nuclear re... | NM_001170765.2 | 93.6% | 93.3% | 1215_1217delGTCinsT;1221_1299del |
| 3 | human | 84458 | LCOR | ligand dependent nuclear re... | NM_032440.4 | 93.6% | 93.3% | 1215_1217delGTCinsT;1221_1299del |
| 4 | mouse | 212391 | Lcor | ligand dependent nuclear re... | NM_172154.4 | 90.6% | 91.4% | (many diffs) |
| 5 | mouse | 212391 | Lcor | ligand dependent nuclear re... | XM_006526849.3 | 90.6% | 91.4% | (many diffs) |
| 6 | mouse | 212391 | Lcor | ligand dependent nuclear re... | XM_006526850.3 | 90.6% | 91.4% | (many diffs) |
| 7 | mouse | 212391 | Lcor | ligand dependent nuclear re... | XM_006526848.3 | 66.2% | 66.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1284
- ORF length:
- 1218
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca gcgaatgatc caacaatttg ctgctgaata tacctcaaaa aatagctcta 121 ctcaggaccc cagccagccc aatagcacaa agaaccaaag cctgccgaaa gcatctccag 181 tcaccacctc tcccacggct gcaactactc agaaccctgt gctcagcaaa cttctcatgg 241 ctgaccaaga ctcacctctg gaccttactg tcagaaagtc tcagtcagaa cctagcgaac 301 aagacggtgt acttgatctg tccactaaga aaagtccatg tgctggcagc acttccctga 361 gccactctcc aggctgctcc agtactcaag ggaacgggcg acctgggaga cccagccagt 421 accgcccaga cggacttcgg agtggtgatg gggtacctcc aagaagctta caggatggaa 481 ccagggaagg ttttggacac tccacatcac tcaaagttcc actggctcga tccctgcaga 541 ttagtgaaga actactgagc agaaaccaat tgtccacagc tgccagcctt gggccatctg 601 gattacagaa tcatggacaa cacttaatat tatccaggga agcctcttgg gcaaaaccac 661 attacgagtt caacctcagc cgtatgaagt tcaggggaaa tggtgcactc agcaacatca 721 gtgaccttcc ttttcttgca gaaaactctg cctttccaaa aatggcactt caagcaaaac 781 aagatggaaa aaaggatgtg agCCATTCAT CTCCTGTAGA TTTAAAGATA CCACAAGTTC 841 GAGGAATGGA TCTTTCTTGG GAGTCTCGCA CTGGTGATCA GTACAGCTAT AGCTCTTTGG 901 TAATGGGTTC ACAAACGGAG AGCGCGCTTA GTAAAAAATT AAGGGCTATT CTTCCAAAAC 961 AAAGTAGAAA AAGCATGTTA GATGCTGGAC CCGATTCTTG GGGCTCAGAT GCTGAGCAGT 1021 CTACCTCTGG ACAGCCATAT CCCACATCGG ATCAAGAAGG AGACCCTGGC TCCAAGCAGC 1081 CTCGGAAGAA AAGAGGGCGT TACAGACAGT ACAACAGTGA GATACTGGAG GAAGCAATCT 1141 CAGTGGTTAT GAGTGGAAAA ATGAGTGTTT CCAAAGCTCA GAGTATTTAT GGGATTCCCC 1201 ACAGTACACT GGAGTACAAA GTAAAGGAGA GGCTGGGCAC TTTGAAAAAC CCTCCAAAGA 1261 AAAAGATGAA ATTAATGAGT GGATGCCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1321 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1381 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAG CATGGCCAGG 1441 CAATCCAATA TCGACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1501 att