Transcript: Human NM_032440.4

Homo sapiens ligand dependent nuclear receptor corepressor (LCOR), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
LCOR (84458)
Length:
10389
CDS:
574..1875

Additional Resources:

NCBI RefSeq record:
NM_032440.4
NBCI Gene record:
LCOR (84458)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032440.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016305 CCAGCCCAATAGCACAAAGAA pLKO.1 642 CDS 100% 5.625 4.500 N LCOR n/a
2 TRCN0000436032 ATCATTGCTTGCACGTAATTT pLKO_005 1939 3UTR 100% 15.000 10.500 N LCOR n/a
3 TRCN0000085107 CCATTCATCTCCTGTAGATTT pLKO.1 1311 CDS 100% 13.200 9.240 N Lcor n/a
4 TRCN0000302091 CCATTCATCTCCTGTAGATTT pLKO_005 1311 CDS 100% 13.200 9.240 N Lcor n/a
5 TRCN0000085104 CCAGATGTTTCTGTAAAGATT pLKO.1 1798 CDS 100% 5.625 3.938 N Lcor n/a
6 TRCN0000331789 CCAGATGTTTCTGTAAAGATT pLKO_005 1798 CDS 100% 5.625 3.938 N Lcor n/a
7 TRCN0000016304 GCCAGATGTTTCTGTAAAGAT pLKO.1 1797 CDS 100% 5.625 3.938 N LCOR n/a
8 TRCN0000016303 GCCATTCATCTCCTGTAGATT pLKO.1 1310 CDS 100% 5.625 3.938 N LCOR n/a
9 TRCN0000085105 CCAATAGCACAAAGAACCAAA pLKO.1 647 CDS 100% 4.950 3.465 N Lcor n/a
10 TRCN0000016306 GCTCAGAGTATTTATGGGATT pLKO.1 1684 CDS 100% 4.050 2.835 N LCOR n/a
11 TRCN0000016307 GTGTACTTGATCTGTCCACTA pLKO.1 815 CDS 100% 4.050 2.835 N LCOR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032440.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04393 pDONR223 100% 93.6% 93.3% None 1215_1217delGTCinsT;1221_1299del n/a
2 ccsbBroad304_04393 pLX_304 0% 93.6% 93.3% V5 1215_1217delGTCinsT;1221_1299del n/a
3 TRCN0000474925 GCATGGCCAGGCAATCCAATATCG pLX_317 39.7% 93.6% 93.3% V5 1215_1217delGTCinsT;1221_1299del n/a
Download CSV