Transcript: Human NM_001170766.2
Homo sapiens ligand dependent nuclear receptor corepressor (LCOR), transcript variant 3, mRNA.
- Source:
- NCBI, updated 2019-09-29
- Taxon:
- Homo sapiens (human)
- Gene:
- LCOR (84458)
- Length:
- 7744
- CDS:
- 506..1726
Additional Resources:
- NCBI RefSeq record:
- NM_001170766.2
- NBCI Gene record:
- LCOR (84458)
sgRNA constructs matching this transcript (CRISPRko, NGG PAM)
This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.
shRNA constructs matching this transcript with 100% SDR[?]The SDR or "Specificity-Defining Region" encompasses the 19 bases within the shRNA stem region that are retained during siRNA processing/production. These are thus the bases that define the target specificity of the shRNA. Note that, while our shRNA designs nearly always extend the stem by two additional bases matching the intended target transcript (reported in the "Target Seq" column), these additional bases are not relevant to target specificity. match
This list includes all shRNAs that have a perfect SDR[?]The SDR or "Specificity-Defining Region" encompasses the 19 bases within the shRNA stem region that are retained during siRNA processing/production. These are thus the bases that define the target specificity of the shRNA. Note that, while our shRNA designs nearly always extend the stem by two additional bases matching the intended target transcript (reported in the "Target Seq" column), these additional bases are not relevant to target specificity. match to Human NM_001170766.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).
| Clone ID | Target Seq | Vector | Match Position | Match Region[?]The region of the transcript where the match occurs (5UTR, CDS, 3UTR). NOTE: all matches to non-coding transcripts are labeled 3UTR. | SDR Match %[?]Percent match of the "Specificity-Defining Region" of the hairpin target sequence to transcript RNA sequence. The SDR is defined as the initial 19 bases of the (21mer) target sequence.
|
Intrinsic Score[?]Also called "original score", this assesses the target sequence for predicted cloneability and knockdown performance. | Adjusted Score[?]Also called "specificity score", this is a function of the intrinsic score and the specificity factor. | Matches Other Human Gene?[?]Does this construct also match another Human gene an equal or better degree? | Orig. Target Gene[?]The gene that this construct was originally designed to target | Addgene[?]Link to this entity's page in the Addgene catalog, if available | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | TRCN0000016305 | CCAGCCCAATAGCACAAAGAA | pLKO.1 | 574 | CDS | 100% | 5.625 | 4.500 | N | LCOR | n/a | ||||||||
| 2 | TRCN0000085107 | CCATTCATCTCCTGTAGATTT | pLKO.1 | 1243 | CDS | 100% | 13.200 | 9.240 | N | Lcor | n/a | ||||||||
| 3 | TRCN0000302091 | CCATTCATCTCCTGTAGATTT | pLKO_005 | 1243 | CDS | 100% | 13.200 | 9.240 | N | Lcor | n/a | ||||||||
| 4 | TRCN0000016303 | GCCATTCATCTCCTGTAGATT | pLKO.1 | 1242 | CDS | 100% | 5.625 | 3.938 | N | LCOR | n/a | ||||||||
| 5 | TRCN0000085105 | CCAATAGCACAAAGAACCAAA | pLKO.1 | 579 | CDS | 100% | 4.950 | 3.465 | N | Lcor | n/a | ||||||||
| 6 | TRCN0000016306 | GCTCAGAGTATTTATGGGATT | pLKO.1 | 1616 | CDS | 100% | 4.050 | 2.835 | N | LCOR | n/a | ||||||||
| 7 | TRCN0000016307 | GTGTACTTGATCTGTCCACTA | pLKO.1 | 747 | CDS | 100% | 4.050 | 2.835 | N | LCOR | n/a |
shRNA constructs with at least a near match to this transcript
This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?]The SDR or "Specificity-Defining Region" encompasses the 19 bases within the shRNA stem region that are retained during siRNA processing/production. These are thus the bases that define the target specificity of the shRNA. Note that, while our shRNA designs nearly always extend the stem by two additional bases matching the intended target transcript (reported in the "Target Seq" column), these additional bases are not relevant to target specificity. match to the transcript NM_001170766.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.
All ORF constructs matching this transcript
| Clone ID | DNA Barcode | Vector | Sequenced %[?]Percentage of construct sequence that has been empirically verified through direct sequence data. | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Epitope Tag | Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | Addgene[?]Link to this entity's page in the Addgene catalog, if available | |
|---|---|---|---|---|---|---|---|---|---|
| 1 | ccsbBroadEn_04393 | pDONR223 | 100% | 100% | 100% | None | n/a | ||
| 2 | ccsbBroad304_04393 | pLX_304 | 0% | 100% | 100% | V5 | n/a | ||
| 3 | TRCN0000474925 | GCATGGCCAGGCAATCCAATATCG | pLX_317 | 39.7% | 100% | 100% | V5 | n/a |