Construct: ORF TRCN0000475006
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012405.1_s317c1
- Derived from:
- ccsbBroadEn_15295
- DNA Barcode:
- CCTGTGCGGAGGTCTCGAGACTGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GK5 (256356)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475006
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 256356 | GK5 | glycerol kinase 5 | XR_002959504.1 | 58.9% | (many diffs) | |
| 2 | human | 256356 | GK5 | glycerol kinase 5 | XM_017006088.1 | 58.2% | 55.9% | (many diffs) |
| 3 | human | 256356 | GK5 | glycerol kinase 5 | NM_001039547.3 | 54.3% | 52.2% | (many diffs) |
| 4 | human | 256356 | GK5 | glycerol kinase 5 | XM_011512624.3 | 38.4% | 36.3% | (many diffs) |
| 5 | human | 256356 | GK5 | glycerol kinase 5 | XM_017006089.2 | 28.8% | 26.5% | (many diffs) |
| 6 | human | 256356 | GK5 | glycerol kinase 5 | XM_024453436.1 | 28.8% | 26.5% | (many diffs) |
| 7 | human | 256356 | GK5 | glycerol kinase 5 | NR_033289.2 | 8.2% | 1_130del;1034_10898del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 969
- ORF length:
- 903
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc ggggctgctc acggacccgg agcagagagc gcaggagccg cggtaccccg 121 gcttcgtgct ggggctggat gtgggcagtt ctgtgatccg ctgccacgtc tatgaccggg 181 cggcgcgggt ctgcggctcc agcgtgcaga aggtagaaaa tctttatcct caaattggct 241 gggtagaaat tgatcctgat gttctttgga ttcaatttgt tgccgtaata aaagaagcag 301 tcaaagctgc aggaatacag atgaatcaaa ttgttggtct tggcatttca acacagagag 361 caacttttat tacgtggaac aagaaaacag gaaatcattt tcacaacttt ataagttggc 421 aagacttaag agctgttgaa cttgtaaaat cttggaataa ttctcttctt atgaagatat 481 ttcacagttc ttgccgagtg cttcactttt tcactagaag taaacgactt tttacagcca 541 gtttgttcac tttcacaacc cagcagactt ctttgagatt ggtctggatt ttaCAGAACT 601 TGACTGAGGT GCAAAAGGCA GTTGAAGAAG AAAATTGCTG CTTTGGGACT ATTGATACCT 661 GGTTGTTATA TAAGCTCACA AAAGGTTCTG TATATGCCAC AGATTTTTCA AATGCTAGTA 721 CAACTGGACT TTTTGACCCA TATAAGATGT GTTGGAGTGG GATGATTACC TCTCTAATTT 781 CGATACCACT TTCTCTCCTA CCTCCTGTGA GGGACACAAG CCACAATTTT GGATCAGTGG 841 ATGAAGAGAT ATTTGGTGTG CCTATACCAA TAGTTGCCTT GTTAAAGGTC CCTGGATATG 901 ACCAGAATAT CTGCTATATT TTTGGGAAGG GGACCATTGA GCCAGTATTC TATCATGGAA 961 GTACTTTATA CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 1021 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1081 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGACCTGTG CGGAGGTCTC GAGACTGAAC 1141 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt