Transcript: Human NR_033289.2

Homo sapiens glycerol kinase 5 (GK5), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
GK5 (256356)
Length:
10898
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_033289.2
NBCI Gene record:
GK5 (256356)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_033289.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000377598 TGGATTACAGGCTCCATTAAA pLKO_005 2347 3UTR 100% 15.000 21.000 N GK5 n/a
2 TRCN0000359785 TTCAATTTGTTGCCGTAATAA pLKO_005 336 3UTR 100% 15.000 21.000 N GK5 n/a
3 TRCN0000078665 GCAGGAATACAGATGAATCAA pLKO.1 374 3UTR 100% 5.625 4.500 N GK5 n/a
4 TRCN0000078667 GTCCCTGGATATGACCAGAAT pLKO.1 953 3UTR 100% 4.950 3.960 N GK5 n/a
5 TRCN0000078663 GCCATCATCTACCAGTAAATA pLKO.1 1255 3UTR 100% 15.000 10.500 N GK5 n/a
6 TRCN0000078664 CCCTGGATATGACCAGAATAT pLKO.1 955 3UTR 100% 13.200 9.240 N GK5 n/a
7 TRCN0000370735 TCCAAAGGACATTAGTCATTT pLKO_005 3043 3UTR 100% 13.200 9.240 N GK5 n/a
8 TRCN0000359717 TTGAAGCCTTCTACCAGTAAA pLKO_005 2399 3UTR 100% 13.200 9.240 N GK5 n/a
9 TRCN0000078666 CCTGATGTTCTTTGGATTCAA pLKO.1 320 3UTR 100% 5.625 3.938 N GK5 n/a
10 TRCN0000359787 ATGACTTCAGACCTGATTAAT pLKO_005 2561 3UTR 100% 15.000 9.000 N GK5 n/a
11 TRCN0000370732 TTGATACCTGGTTGTTATATA pLKO_005 717 3UTR 100% 15.000 9.000 N GK5 n/a
12 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 5664 3UTR 100% 10.800 5.400 Y MRPS16 n/a
13 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 5036 3UTR 100% 10.800 5.400 Y SMIM11A n/a
14 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 10270 3UTR 100% 4.950 2.475 Y ORAI2 n/a
15 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 8297 3UTR 100% 4.950 2.475 Y ERAP2 n/a
16 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4876 3UTR 100% 13.200 6.600 Y LIAS n/a
17 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 5664 3UTR 100% 10.800 5.400 Y CD3EAP n/a
18 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 8153 3UTR 100% 4.950 2.475 Y ERN2 n/a
19 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 8153 3UTR 100% 4.950 2.475 Y P3H4 n/a
20 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 8153 3UTR 100% 4.950 2.475 Y P3H4 n/a
21 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 7593 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_033289.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10332 pDONR223 100% 8.2% None 1_130del;1034_10898del n/a
2 ccsbBroad304_10332 pLX_304 0% 8.2% V5 1_130del;1034_10898del n/a
3 ccsbBroadEn_15295 pDONR223 0% 8.2% None 1_130del;1034_10898del n/a
4 ccsbBroad304_15295 pLX_304 0% 8.2% V5 1_130del;1034_10898del n/a
5 TRCN0000475006 CCTGTGCGGAGGTCTCGAGACTGA pLX_317 41.8% 8.2% V5 1_130del;1034_10898del n/a
Download CSV