Transcript: Human XM_024453436.1

PREDICTED: Homo sapiens glycerol kinase 5 (GK5), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GK5 (256356)
Length:
3846
CDS:
1017..2198

Additional Resources:

NCBI RefSeq record:
XM_024453436.1
NBCI Gene record:
GK5 (256356)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453436.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000377598 TGGATTACAGGCTCCATTAAA pLKO_005 1742 CDS 100% 15.000 21.000 N GK5 n/a
2 TRCN0000359785 TTCAATTTGTTGCCGTAATAA pLKO_005 336 5UTR 100% 15.000 21.000 N GK5 n/a
3 TRCN0000078665 GCAGGAATACAGATGAATCAA pLKO.1 374 5UTR 100% 5.625 4.500 N GK5 n/a
4 TRCN0000370735 TCCAAAGGACATTAGTCATTT pLKO_005 2438 3UTR 100% 13.200 9.240 N GK5 n/a
5 TRCN0000359717 TTGAAGCCTTCTACCAGTAAA pLKO_005 1794 CDS 100% 13.200 9.240 N GK5 n/a
6 TRCN0000078666 CCTGATGTTCTTTGGATTCAA pLKO.1 320 5UTR 100% 5.625 3.938 N GK5 n/a
7 TRCN0000359787 ATGACTTCAGACCTGATTAAT pLKO_005 1956 CDS 100% 15.000 9.000 N GK5 n/a
8 TRCN0000370732 TTGATACCTGGTTGTTATATA pLKO_005 1195 CDS 100% 15.000 9.000 N GK5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453436.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10332 pDONR223 100% 28.8% 26.5% None (many diffs) n/a
2 ccsbBroad304_10332 pLX_304 0% 28.8% 26.5% V5 (many diffs) n/a
3 ccsbBroadEn_15295 pDONR223 0% 28.8% 26.5% None (many diffs) n/a
4 ccsbBroad304_15295 pLX_304 0% 28.8% 26.5% V5 (many diffs) n/a
5 TRCN0000475006 CCTGTGCGGAGGTCTCGAGACTGA pLX_317 41.8% 28.8% 26.5% V5 (many diffs) n/a
Download CSV