Construct: ORF TRCN0000475017
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002188.1_s317c1
- Derived from:
- ccsbBroadEn_07801
- DNA Barcode:
- CGCCGCCCCTCCTTCCGCCCGTTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RNF13 (11342)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475017
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 11342 | RNF13 | ring finger protein 13 | NM_007282.4 | 99.9% | 100% | 789C>T |
2 | human | 11342 | RNF13 | ring finger protein 13 | NM_183381.2 | 99.9% | 100% | 789C>T |
3 | human | 11342 | RNF13 | ring finger protein 13 | XM_011512373.2 | 99.9% | 100% | 789C>T |
4 | human | 11342 | RNF13 | ring finger protein 13 | XM_011512374.2 | 99.9% | 100% | 789C>T |
5 | human | 11342 | RNF13 | ring finger protein 13 | XM_017005654.1 | 99.9% | 100% | 789C>T |
6 | human | 11342 | RNF13 | ring finger protein 13 | XM_017005655.1 | 99.9% | 100% | 789C>T |
7 | human | 11342 | RNF13 | ring finger protein 13 | XM_024453332.1 | 99.9% | 100% | 789C>T |
8 | human | 11342 | RNF13 | ring finger protein 13 | NM_183383.2 | 67.2% | 63.7% | 0_1ins367;43_52delGTAAGTACAG;432C>T |
9 | human | 11342 | RNF13 | ring finger protein 13 | XM_005247092.4 | 67.2% | 63.7% | 0_1ins367;43_52delGTAAGTACAG;432C>T |
10 | human | 11342 | RNF13 | ring finger protein 13 | XM_011512376.2 | 67.2% | 63.7% | 0_1ins367;43_52delGTAAGTACAG;432C>T |
11 | human | 11342 | RNF13 | ring finger protein 13 | XM_017005656.1 | 67.2% | 63.7% | 0_1ins367;43_52delGTAAGTACAG;432C>T |
12 | human | 11342 | RNF13 | ring finger protein 13 | XM_017005657.1 | 67.2% | 63.7% | 0_1ins367;43_52delGTAAGTACAG;432C>T |
13 | human | 11342 | RNF13 | ring finger protein 13 | XM_017005658.1 | 67.2% | 63.7% | 0_1ins367;43_52delGTAAGTACAG;432C>T |
14 | human | 11342 | RNF13 | ring finger protein 13 | XM_017005660.1 | 65.5% | 65.6% | 0_1ins393;396C>T |
15 | human | 11342 | RNF13 | ring finger protein 13 | XM_017005661.2 | 48.4% | 47.5% | (many diffs) |
16 | human | 11342 | RNF13 | ring finger protein 13 | XR_002959487.1 | 46.4% | (many diffs) | |
17 | human | 11342 | RNF13 | ring finger protein 13 | XR_001739990.2 | 39.8% | (many diffs) | |
18 | mouse | 24017 | Rnf13 | ring finger protein 13 | NM_001113413.2 | 89.6% | 93.4% | (many diffs) |
19 | mouse | 24017 | Rnf13 | ring finger protein 13 | XM_006501457.3 | 89.6% | 93.4% | (many diffs) |
20 | mouse | 24017 | Rnf13 | ring finger protein 13 | XM_006501458.3 | 83.1% | 86.6% | (many diffs) |
21 | mouse | 24017 | Rnf13 | ring finger protein 13 | NM_001304454.1 | 82.6% | 85.8% | (many diffs) |
22 | mouse | 24017 | Rnf13 | ring finger protein 13 | NM_011883.4 | 63.5% | 66.4% | (many diffs) |
23 | mouse | 24017 | Rnf13 | ring finger protein 13 | NM_001304456.1 | 59% | 59.5% | (many diffs) |
24 | mouse | 24017 | Rnf13 | ring finger protein 13 | NR_130743.1 | 28.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1209
- ORF length:
- 1143
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgct gctctccata gggatgctca tgctgtcagc cacacaagtc tacaccatct 121 tgactgtcca gctctttgca ttcttaaacc tactgcctgt agaagcagac attttagcat 181 ataactttga aaatgcatct cagacatttg atgacctccc tgcaagattt ggttatagac 241 ttccagctga aggtttaaag ggttttttga ttaactcaaa accagagaat gcctgtgaac 301 ccatagtgcc tccaccagta aaagacaatt catctggcac tttcatcgtg ttaattagaa 361 gacttgattg taattttgat ataaaggttt taaatgcaca gagagcagga tacaaggcag 421 ccatagttca caatgttgat tctgatgacc tcattagcat gggatccaac gacattgagg 481 tactaaagaa aattgacatt ccatctgtct ttattggtga atcatcagct aattctctga 541 aagatgaatt cacatatgaa aaagggggcc accttatctt agttccagaa tttagtcttc 601 ctttggaata ctacctaatt cccttcctta tcatagtggg catctgtctc atcttgatag 661 tcattttcat gatcacaaaa tttgtccagg atagacatag agctagaaga aacagacttc 721 gtaaagatca acttaagaaa cttcctgtac ataaattcaa gaaaggagat gagtatgatg 781 tatgtgccat ttgtttggat gagtatgaag atggagacaa actcagaatc cttccctgtt 841 cccatgctta tcattgcaag tgtgtagacc cttggctaac taaaaccaaa aaaacctgtc 901 cagtgtgcaa gcaaaaagtt gttccttctc aaggcgattc agactctgac acagacagta 961 gtcaagaaga aaatgaagtg acagaacata cccctttact gagaccttta gcttctgtca 1021 gtgcccagtc atttggggct ttatcggaat cccgctcaca tcagaacatg acagaatctt 1081 cagactatga ggaagacgac aatgaagata ctgacagtag tgatgcagaa aatgaaatta 1141 atgaacatga tgtcgtggtC CAGTTGCAGC CTAATGGTGA ACGGGATTAC AACATAGCAA 1201 ATACTGTTTG CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 1261 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1321 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGACGCCGC CCCTCCTTCC GCCCGTTTAC 1381 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt