Transcript: Human NM_183383.2

Homo sapiens ring finger protein 13 (RNF13), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
RNF13 (11342)
Length:
2743
CDS:
920..1708

Additional Resources:

NCBI RefSeq record:
NM_183383.2
NBCI Gene record:
RNF13 (11342)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_183383.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004262 CTTTACTGAGACCTTTAGCTT pLKO.1 1491 CDS 100% 3.000 2.100 N RNF13 n/a
2 TRCN0000318523 CTTTACTGAGACCTTTAGCTT pLKO_005 1491 CDS 100% 3.000 2.100 N RNF13 n/a
3 TRCN0000004263 CCTCCTATCAGCACAAAGAAA pLKO.1 2187 3UTR 100% 5.625 3.375 N RNF13 n/a
4 TRCN0000318525 CCTCCTATCAGCACAAAGAAA pLKO_005 2187 3UTR 100% 5.625 3.375 N RNF13 n/a
5 TRCN0000004260 GAACGGGATTACAACATAGCA pLKO.1 1676 CDS 100% 3.000 1.800 N RNF13 n/a
6 TRCN0000318583 GAACGGGATTACAACATAGCA pLKO_005 1676 CDS 100% 3.000 1.800 N RNF13 n/a
7 TRCN0000004259 GACTATGAGGAAGACGACAAT pLKO.1 1580 CDS 100% 4.950 2.475 Y RNF13 n/a
8 TRCN0000318582 GACTATGAGGAAGACGACAAT pLKO_005 1580 CDS 100% 4.950 2.475 Y RNF13 n/a
9 TRCN0000305252 CTTCGTAAAGATCAACTTAAA pLKO_005 1214 CDS 100% 13.200 9.240 N Rnf13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183383.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07801 pDONR223 100% 67.2% 63.7% None 0_1ins367;43_52delGTAAGTACAG;432C>T n/a
2 ccsbBroad304_07801 pLX_304 0% 67.2% 63.7% V5 0_1ins367;43_52delGTAAGTACAG;432C>T n/a
3 TRCN0000475017 CGCCGCCCCTCCTTCCGCCCGTTT pLX_317 5.1% 67.2% 63.7% V5 0_1ins367;43_52delGTAAGTACAG;432C>T n/a
Download CSV