Transcript: Mouse NM_001304454.1

Mus musculus ring finger protein 13 (Rnf13), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Rnf13 (24017)
Length:
2785
CDS:
152..1210

Additional Resources:

NCBI RefSeq record:
NM_001304454.1
NBCI Gene record:
Rnf13 (24017)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001304454.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041054 CCAACGACATTGATACACTAA pLKO.1 552 CDS 100% 4.950 6.930 N Rnf13 n/a
2 TRCN0000349338 CCAACGACATTGATACACTAA pLKO_005 552 CDS 100% 4.950 6.930 N Rnf13 n/a
3 TRCN0000041057 GCACGTTCATCGTGCTGATTA pLKO.1 423 CDS 100% 1.320 1.848 N Rnf13 n/a
4 TRCN0000305252 CTTCGTAAAGATCAACTTAAA pLKO_005 803 CDS 100% 13.200 9.240 N Rnf13 n/a
5 TRCN0000041055 GCCTCATCTTAATAGTCATTT pLKO.1 732 CDS 100% 13.200 9.240 N Rnf13 n/a
6 TRCN0000316879 GCCTCATCTTAATAGTCATTT pLKO_005 732 CDS 100% 13.200 9.240 N Rnf13 n/a
7 TRCN0000305251 GGAGTATGAAGACGGAGATAA pLKO_005 886 CDS 100% 13.200 9.240 N Rnf13 n/a
8 TRCN0000041056 GCAGGATACAAAGCAGCCATA pLKO.1 491 CDS 100% 4.050 2.835 N Rnf13 n/a
9 TRCN0000316878 GCAGGATACAAAGCAGCCATA pLKO_005 491 CDS 100% 4.050 2.835 N Rnf13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001304454.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07801 pDONR223 100% 82.6% 85.8% None (many diffs) n/a
2 ccsbBroad304_07801 pLX_304 0% 82.6% 85.8% V5 (many diffs) n/a
3 TRCN0000475017 CGCCGCCCCTCCTTCCGCCCGTTT pLX_317 5.1% 82.6% 85.8% V5 (many diffs) n/a
Download CSV