Construct: ORF TRCN0000475106
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014083.1_s317c1
- Derived from:
- ccsbBroadEn_00707
- DNA Barcode:
- AAATTTATGTCATTTCTTGCCTTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GTF2E2 (2961)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475106
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2961 | GTF2E2 | general transcription facto... | NM_002095.6 | 100% | 100% | |
| 2 | human | 2961 | GTF2E2 | general transcription facto... | XM_017013363.1 | 100% | 100% | |
| 3 | human | 2961 | GTF2E2 | general transcription facto... | XM_017013364.1 | 100% | 100% | |
| 4 | human | 2961 | GTF2E2 | general transcription facto... | XM_024447138.1 | 100% | 100% | |
| 5 | human | 2961 | GTF2E2 | general transcription facto... | NM_001348353.1 | 75.2% | 73.8% | (many diffs) |
| 6 | human | 2961 | GTF2E2 | general transcription facto... | XM_011544509.2 | 75.2% | 73.8% | (many diffs) |
| 7 | human | 2961 | GTF2E2 | general transcription facto... | XM_011544510.1 | 74.5% | 73.8% | 644_645ins22;648_649insCTGTAGATT;651_652ins191 |
| 8 | mouse | 68153 | Gtf2e2 | general transcription facto... | NM_001167921.1 | 90.1% | 94.1% | (many diffs) |
| 9 | mouse | 68153 | Gtf2e2 | general transcription facto... | NM_001167922.1 | 90.1% | 94.1% | (many diffs) |
| 10 | mouse | 68153 | Gtf2e2 | general transcription facto... | NM_026584.3 | 90.1% | 94.1% | (many diffs) |
| 11 | mouse | 68153 | Gtf2e2 | general transcription facto... | XM_006509186.1 | 90.1% | 94.1% | (many diffs) |
| 12 | mouse | 68153 | Gtf2e2 | general transcription facto... | XM_006509187.1 | 90.1% | 94.1% | (many diffs) |
| 13 | mouse | 68153 | Gtf2e2 | general transcription facto... | XM_006509188.3 | 90.1% | 94.1% | (many diffs) |
| 14 | mouse | 68153 | Gtf2e2 | general transcription facto... | XM_006509185.3 | 89.2% | 93.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 939
- ORF length:
- 873
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga tccaagcctg ttgagagaaa gggagctgtt caaaaaacga gctctttcta 121 ctcctgtagt agaaaaacgt tcagcatctt ctgagtcatc atcatcatcg tcaaagaaga 181 agaaaacaaa ggtagaacat ggaggatcgt caggctctaa acaaaattct gatcatagca 241 atggatcatt taacttgaaa gctttgtcag gaagctctgg atataagttt ggtgttcttg 301 ctaagattgt gaattacatg aagacacggc atcagcgagg agatacgcat cctctaacct 361 tagatgaaat tttggatgaa acacaacatt tagatattgg actcaagcag aaacaatggc 421 taatgactga ggctttagtc aacaatccca aaattgaagt aatagatggg aagtatgctt 481 tcaagcccaa gtacaacgtg agagataaga aggccctact taggctctta gatcagcatg 541 accagcgagg attaggagga attcttttag aagacataga agaagcactg cccaattccc 601 agaaagctgt caaggctttg ggggaccaga tactatttgt aaaTCGTCCC GATAAGAAGA 661 AAATACTTTT CTTCAATGAT AAGAGCTGTC AGTTTTCTGT GGATGAAGAA TTTCAGAAAC 721 TGTGGAGGAG TGTCACTGTA GATTCCATGG ACGAGGAGAA AATTGAAGAA TATCTGAAGC 781 GACAGGGTAT TTCTTCCATG CAGGAATCTG GACCAAAGAA AGTGGCCCCT ATTCAGAGAA 841 GGAAAAAGCC TGCTTCACAG AAAAAGCGAC GCTTTAAGAC TCATAACGAA CACTTGGCTG 901 GAGTGCTGAA GGATTACTCT GACATTACTT CCAGCAAATA CCCAACTTTC TTGTACAAAG 961 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 1021 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 1081 ACGAAAATTT ATGTCATTTC TTGCCTTTAC GCGTTAAGTC gacaatcaac ctctggatta 1141 caaaatttgt gaaagatt