Transcript: Human XM_024447138.1

PREDICTED: Homo sapiens general transcription factor IIE subunit 2 (GTF2E2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GTF2E2 (2961)
Length:
1564
CDS:
284..1159

Additional Resources:

NCBI RefSeq record:
XM_024447138.1
NBCI Gene record:
GTF2E2 (2961)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447138.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000020776 GCGACGCTTTAAGACTCATAA pLKO.1 1084 CDS 100% 13.200 18.480 N GTF2E2 n/a
2 TRCN0000414683 TCTGAAGCGACAGGGTATTTC pLKO_005 991 CDS 100% 13.200 18.480 N GTF2E2 n/a
3 TRCN0000433263 ATTTGTAAATCGTCCCGATAA pLKO_005 853 CDS 100% 10.800 15.120 N GTF2E2 n/a
4 TRCN0000020778 GCCCTACTTAGGCTCTTAGAT pLKO.1 731 CDS 100% 5.625 7.875 N GTF2E2 n/a
5 TRCN0000020777 CCTCTAACCTTAGATGAAATT pLKO.1 569 CDS 100% 13.200 9.240 N GTF2E2 n/a
6 TRCN0000415967 GATCATAGCAATGGATCATTT pLKO_005 449 CDS 100% 13.200 9.240 N GTF2E2 n/a
7 TRCN0000418171 AGCATGACCAGCGAGGATTAG pLKO_005 753 CDS 100% 10.800 7.560 N GTF2E2 n/a
8 TRCN0000020774 CCCTGGAACAGAGTTACAGAT pLKO.1 1172 3UTR 100% 4.950 3.465 N GTF2E2 n/a
9 TRCN0000020775 GCTTTAGTCAACAATCCCAAA pLKO.1 650 CDS 100% 4.050 2.835 N GTF2E2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447138.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00707 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00707 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475106 AAATTTATGTCATTTCTTGCCTTT pLX_317 34.2% 100% 100% V5 n/a
Download CSV