Transcript: Mouse NM_001167922.1

Mus musculus general transcription factor II E, polypeptide 2 (beta subunit) (Gtf2e2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Gtf2e2 (68153)
Length:
1664
CDS:
182..1060

Additional Resources:

NCBI RefSeq record:
NM_001167922.1
NBCI Gene record:
Gtf2e2 (68153)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001167922.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085599 CGACGGTTTAAGACTCACAAT pLKO.1 986 CDS 100% 4.950 6.930 N Gtf2e2 n/a
2 TRCN0000301979 CGACGGTTTAAGACTCACAAT pLKO_005 986 CDS 100% 4.950 6.930 N Gtf2e2 n/a
3 TRCN0000414683 TCTGAAGCGACAGGGTATTTC pLKO_005 892 CDS 100% 13.200 9.240 N GTF2E2 n/a
4 TRCN0000085602 CTTCAAACCTAAGTACAACTT pLKO.1 598 CDS 100% 4.950 3.465 N Gtf2e2 n/a
5 TRCN0000301977 CTTCAAACCTAAGTACAACTT pLKO_005 598 CDS 100% 4.950 3.465 N Gtf2e2 n/a
6 TRCN0000085598 CCTGTTTAACTTTCTGGGTTT pLKO.1 1253 3UTR 100% 4.050 2.835 N Gtf2e2 n/a
7 TRCN0000085601 GCTGAAGGATTACTCGGACAT pLKO.1 1024 CDS 100% 4.050 2.835 N Gtf2e2 n/a
8 TRCN0000301915 GCTGAAGGATTACTCGGACAT pLKO_005 1024 CDS 100% 4.050 2.835 N Gtf2e2 n/a
9 TRCN0000085600 GCTTTAGTCAACAATCCTAAA pLKO.1 551 CDS 100% 1.080 0.756 N Gtf2e2 n/a
10 TRCN0000301914 GCTTTAGTCAACAATCCTAAA pLKO_005 551 CDS 100% 1.080 0.756 N Gtf2e2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001167922.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00707 pDONR223 100% 90.1% 94.1% None (many diffs) n/a
2 ccsbBroad304_00707 pLX_304 0% 90.1% 94.1% V5 (many diffs) n/a
3 TRCN0000475106 AAATTTATGTCATTTCTTGCCTTT pLX_317 34.2% 90.1% 94.1% V5 (many diffs) n/a
Download CSV