Construct: ORF TRCN0000475111
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005841.1_s317c1
- Derived from:
- ccsbBroadEn_13090
- DNA Barcode:
- AGTGCACTGAATGTGTTGGATAAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PLD4 (122618)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475111
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 122618 | PLD4 | phospholipase D family memb... | NM_138790.4 | 96.6% | 96.6% | 1_51del |
| 2 | human | 122618 | PLD4 | phospholipase D family memb... | NM_001308174.2 | 95.3% | 95.3% | 1_72del |
| 3 | human | 122618 | PLD4 | phospholipase D family memb... | XM_024449470.1 | 91.7% | 91.7% | 1_51del;1224_1304del |
| 4 | human | 122618 | PLD4 | phospholipase D family memb... | XM_024449469.1 | 90.5% | 90.5% | 1_72del;1245_1325del |
| 5 | human | 122618 | PLD4 | phospholipase D family memb... | XM_017020965.1 | 85.6% | 82.3% | (many diffs) |
| 6 | human | 122618 | PLD4 | phospholipase D family memb... | XM_011536411.2 | 84.4% | 81.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1533
- ORF length:
- 1467
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc gccccgccgc ccgtgggaca gagaggctgg cacgttgcag gtcctgggag 121 cgctggctgt gctgtggctg ggctccgtgg ctcttatctg cctcctgtgg caagtgcccc 181 gtcctcccac ctggggccag gtgcagccca aggacgtgcc caggtcctgg gagcatggct 241 ccagcccagc ttgggagccc ctggaagcag aggccaggca gcagagggac tcctgccagc 301 ttgtccttgt ggaaagcatc ccccaggacc tgccatctgc agccggcagc ccctctgccc 361 agcctctggg ccaggcctgg ctgcagctgc tggacactgc ccaggagagc gtccacgtgg 421 cttcatacta ctggtccctc acagggcctg acatcggggt caacgactcg tcttcccagc 481 tgggagaggc tcttctgcag aagctgcagc agctgctggg caggaacatt tccctggctg 541 tggccaccag cagcccgaca ctggccagga catccaccga cctgcaggtt ctggctgccc 601 gaggtgccca tgtacgacag gtgcccatgg ggcggctcac caggggtgtt ttgcactcca 661 aattctgggt tgtggatgga cggcacatat acatgggcag tgccaacatg gactggcggt 721 ctctgacgca ggtgaaggag cttggcgctg tcatctataa ctgcagccac ctggcccaag 781 acctggagaa gaccttccag acctactggg tactgggggt gcccaaggct gtcctcccca 841 aaacctggcc tcagaacttc tcatctcact tcaaccgttt ccagcccttc cacggcctct 901 ttgatggggt gcccaccact gcctacttct cagcgtcgcc accagcactc tgtccccagg 961 gccgcacccg ggacctggag gcgctgctgg cggtgatggg gagcgcccag gagttcatct 1021 atgcctccgt gatggagtat ttccccacca cgcgcttcag ccaccccccg aggtactggc 1081 cggtgctgga caacgcgctg cgggcggcag ccttcggcaa gggcgtgcgc gtgcgcctgc 1141 tggtcggctg cggactcaac acggacccca ccatgttccc ctacctgcgg tccctgcagg 1201 cgctcagcaa ccccgcggcc aacgtctctg tggacgtgaa agtcttcatc gtgccggtgg 1261 ggaaccattc caacatccca ttcagcaggg tgaaccacag caagttcatg gtcacggaga 1321 aggcagccta cataggcacc tccaactggt cggaggatta cttcagcagc acggcggggg 1381 tgggcttggt ggtcacccag agccctggcg cgcagcccgc gggggccacg gtgcaggagc 1441 agctgcggca gctctttgag cgggactgga gttcgcgcTA CGCCGTCGGC CTGGACGGAC 1501 AGGCTCCGGG CCAGGACTGC GTTTGGCAGG GCTGCCCAAC TTTCTTGTAC AAAGTGGTTG 1561 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 1621 GTCCGTAACT TGAAAGATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGAAGT 1681 GCACTGAATG TGTTGGATAA GACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt 1741 tgtgaaagat t