Transcript: Human XM_017020965.1

PREDICTED: Homo sapiens phospholipase D family member 4 (PLD4), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLD4 (122618)
Length:
2057
CDS:
113..1480

Additional Resources:

NCBI RefSeq record:
XM_017020965.1
NBCI Gene record:
PLD4 (122618)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020965.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050284 CAAGTTCATGGTCACGGAGAA pLKO.1 1399 CDS 100% 4.050 5.670 N PLD4 n/a
2 TRCN0000050287 GCGGTCTCTGACGCAGGTGAA pLKO.1 814 CDS 100% 0.000 0.000 N PLD4 n/a
3 TRCN0000050286 TGCCTCCGTGATGGAGTATTT pLKO.1 1120 CDS 100% 13.200 9.240 N PLD4 n/a
4 TRCN0000050283 CTCATCTCACTTCAACCGTTT pLKO.1 958 CDS 100% 4.050 2.835 N PLD4 n/a
5 TRCN0000050285 GCTTGTCCTTGTGGAAAGCAT pLKO.1 397 CDS 100% 3.000 2.100 N PLD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020965.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13090 pDONR223 100% 85.6% 82.3% None (many diffs) n/a
2 ccsbBroad304_13090 pLX_304 0% 85.6% 82.3% V5 (many diffs) n/a
3 TRCN0000475111 AGTGCACTGAATGTGTTGGATAAG pLX_317 4.3% 85.6% 82.3% V5 (many diffs) n/a
Download CSV