Transcript: Human NM_001308174.2

Homo sapiens phospholipase D family member 4 (PLD4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-28
Taxon:
Homo sapiens (human)
Gene:
PLD4 (122618)
Length:
6492
CDS:
130..1671

Additional Resources:

NCBI RefSeq record:
NM_001308174.2
NBCI Gene record:
PLD4 (122618)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001308174.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050284 CAAGTTCATGGTCACGGAGAA pLKO.1 1437 CDS 100% 4.050 5.670 N PLD4 n/a
2 TRCN0000050287 GCGGTCTCTGACGCAGGTGAA pLKO.1 852 CDS 100% 0.000 0.000 N PLD4 n/a
3 TRCN0000050286 TGCCTCCGTGATGGAGTATTT pLKO.1 1158 CDS 100% 13.200 9.240 N PLD4 n/a
4 TRCN0000050283 CTCATCTCACTTCAACCGTTT pLKO.1 996 CDS 100% 4.050 2.835 N PLD4 n/a
5 TRCN0000050285 GCTTGTCCTTGTGGAAAGCAT pLKO.1 435 CDS 100% 3.000 2.100 N PLD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001308174.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13090 pDONR223 100% 95.3% 95.3% None 1_72del n/a
2 ccsbBroad304_13090 pLX_304 0% 95.3% 95.3% V5 1_72del n/a
3 TRCN0000475111 AGTGCACTGAATGTGTTGGATAAG pLX_317 4.3% 95.3% 95.3% V5 1_72del n/a
Download CSV