Construct: ORF TRCN0000475118
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011014.1_s317c1
- Derived from:
- ccsbBroadEn_10100
- DNA Barcode:
- TGCCAGGTCTATTCATTATTGCCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- IYD (389434)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475118
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 389434 | IYD | iodotyrosine deiodinase | NM_203395.3 | 99.8% | 99.6% | 779T>C |
| 2 | human | 389434 | IYD | iodotyrosine deiodinase | NM_001164695.2 | 80% | 80.2% | (many diffs) |
| 3 | human | 389434 | IYD | iodotyrosine deiodinase | NM_001164694.2 | 78.3% | 77% | 685_796del;879_880ins100 |
| 4 | human | 389434 | IYD | iodotyrosine deiodinase | XM_006715478.3 | 78.1% | 76.8% | 685_799del;882_883ins100 |
| 5 | human | 389434 | IYD | iodotyrosine deiodinase | NM_001318495.2 | 71.5% | 60.2% | 0_1ins178;123_124ins68;533T>C |
| 6 | human | 389434 | IYD | iodotyrosine deiodinase | XM_006715479.3 | 59.5% | 58% | (many diffs) |
| 7 | human | 389434 | IYD | iodotyrosine deiodinase | NR_134655.2 | 9.8% | (many diffs) | |
| 8 | mouse | 70337 | Iyd | iodotyrosine deiodinase | NM_027391.3 | 83% | 84.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 933
- ORF length:
- 867
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgta tttcctgact cccatcttgg tagccattct ctgcattttg gttgtgtgga 121 tctttaaaaa tgccgacaga agcatggaga aaaagaaggg ggagcctaga accagggccg 181 aagctcgccc ctgggtggat gaagacttaa aagacagcag tgacctgcac caagcagaag 241 aagatgctga tgaatggcaa gaatcagaag aaaatgttga acacatcccc ttctctcata 301 accactatcc tgagaaggaa atggttaaga ggtctcagga attttatgaa cttctcaata 361 agagacggtc agtcaggttc ataagtaatg agcaagtccc aatggaagtc attgataatg 421 tcatcagaac ggcaggaaca gccccgagtg gggctcacac agagccctgg accttcgtgg 481 ttgtgaagga cccagacgtg aagcacaaga ttcgaaagat cattgaggag gaagaggaga 541 tcaactacat gaaaaggatg ggacatcgct gGGTCACAGA CCTCAAGAAA CTGAGAACCA 601 ACTGGATTAA AGAGTACTTG GATACTGCCC CTATTTTGAT TCTCATTTTC AAACAAGTAC 661 ATGGTTTCGC CGCAAATGGC AAGAAAAAAG TCCACTACTA CAATGAGATC AGTGTTTCCA 721 TCGCTTGTGG CATCCTGCTA GCTGCCCTGC AGAATGCAGG TCTGGTGACT GTCACTACCA 781 CTCCTCTCAA CTGTGGCCCT CGACTGAGGG TGCTCCTGGG CCGCCCCGCA CATGAAAAGC 841 TGCCGATGCT GCTCCCCGTG GGGTACCCCA GCAAGGAGGC CACGGTGCCT GACCTCAAGC 901 GCAAACCTCT GGACCAGATC ATGGTGACAG TGTACCCAAC TTTCTTGTAC AAAGTGGTTG 961 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 1021 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGATG 1081 CCAGGTCTAT TCATTATTGC CTACGCGTTA AGTCgacaat caacctctgg attacaaaat 1141 ttgtgaaaga tt