Transcript: Human XM_006715478.3

PREDICTED: Homo sapiens iodotyrosine deiodinase (IYD), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IYD (389434)
Length:
1156
CDS:
179..1063

Additional Resources:

NCBI RefSeq record:
XM_006715478.3
NBCI Gene record:
IYD (389434)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006715478.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064232 GTACATGGTTTCGCCGCAAAT pLKO.1 770 CDS 100% 10.800 15.120 N IYD n/a
2 TRCN0000064229 CCTGGGTGGATGAAGACTTAA pLKO.1 303 CDS 100% 13.200 9.240 N IYD n/a
3 TRCN0000424306 ACGGTCAGTCAGGTTCATAAG pLKO_005 478 CDS 100% 10.800 7.560 N IYD n/a
4 TRCN0000064228 CCAGACGTGAAGCACAAGATT pLKO.1 605 CDS 100% 5.625 3.938 N IYD n/a
5 TRCN0000064230 CCAATGGAAGTCATTGATAAT pLKO.1 512 CDS 100% 1.320 0.924 N IYD n/a
6 TRCN0000064231 GCAGAAGAAGATGCTGATGAA pLKO.1 347 CDS 100% 4.950 2.970 N IYD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006715478.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10100 pDONR223 100% 78.1% 76.8% None 685_799del;882_883ins100 n/a
2 ccsbBroad304_10100 pLX_304 0% 78.1% 76.8% V5 685_799del;882_883ins100 n/a
3 TRCN0000475118 TGCCAGGTCTATTCATTATTGCCT pLX_317 41.9% 78.1% 76.8% V5 685_799del;882_883ins100 n/a
Download CSV