Transcript: Mouse NM_027391.3

Mus musculus iodotyrosine deiodinase (Iyd), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Iyd (70337)
Length:
1540
CDS:
18..875

Additional Resources:

NCBI RefSeq record:
NM_027391.3
NBCI Gene record:
Iyd (70337)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027391.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000279389 AGACGCTCCGTCAGGTTTATC pLKO_005 303 CDS 100% 13.200 18.480 N Iyd n/a
2 TRCN0000202105 CACGTCCCAATGGAAGTCATT pLKO.1 333 CDS 100% 4.950 3.960 N Iyd n/a
3 TRCN0000279387 ACTTTCAGTCCAGTAAGTTAT pLKO_005 1031 3UTR 100% 13.200 9.240 N Iyd n/a
4 TRCN0000279388 TCTTGGTTGTATGGGTCTTTA pLKO_005 58 CDS 100% 13.200 9.240 N Iyd n/a
5 TRCN0000190953 CCCAGACATGAAGCATAAGAT pLKO.1 431 CDS 100% 5.625 3.938 N Iyd n/a
6 TRCN0000279454 CCCAGACATGAAGCATAAGAT pLKO_005 431 CDS 100% 5.625 3.938 N Iyd n/a
7 TRCN0000192826 GAAGCATAAGATCAGAGAGAT pLKO.1 440 CDS 100% 4.950 3.465 N Iyd n/a
8 TRCN0000189541 CAACGAGATCAGTGTGTCCAT pLKO.1 641 CDS 100% 2.640 1.848 N Iyd n/a
9 TRCN0000279386 CAACGAGATCAGTGTGTCCAT pLKO_005 641 CDS 100% 2.640 1.848 N Iyd n/a
10 TRCN0000192070 CAATCTTGAATGAGTGACCTT pLKO.1 1334 3UTR 100% 2.640 1.848 N Iyd n/a
11 TRCN0000064229 CCTGGGTGGATGAAGACTTAA pLKO.1 130 CDS 100% 13.200 9.240 N IYD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027391.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10100 pDONR223 100% 83% 84.4% None (many diffs) n/a
2 ccsbBroad304_10100 pLX_304 0% 83% 84.4% V5 (many diffs) n/a
3 TRCN0000475118 TGCCAGGTCTATTCATTATTGCCT pLX_317 41.9% 83% 84.4% V5 (many diffs) n/a
Download CSV