Construct: ORF TRCN0000475138
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015708.1_s317c1
- Derived from:
- ccsbBroadEn_15676
- DNA Barcode:
- AACGATTTTACCAGCGTGTTCTGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LAPTM4A (9741)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475138
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 9741 | LAPTM4A | lysosomal protein transmemb... | NM_014713.5 | 100% | 100% | |
2 | mouse | 17775 | Laptm4a | lysosomal-associated protei... | NM_008640.2 | 69.6% | 73.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 765
- ORF length:
- 699
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggt gtccatgagt ttcaagcgga accgcagtga ccggttctac agcacccggt 121 gctgcggctg ttgccatgtc cgcaccggga cgatcatcct ggggacctgg tacatggtag 181 taaacctatt gatggcaatt ttgctgactg tggaagtgac tcatccaaac tccatgccag 241 ctgtcaacat tcagtatgaa gtcatcggta attactattc gtctgagaga atggctgata 301 atgcctgtgt tctttttgcc gtctctgttc ttatgtttat aatcagttca atgctggttt 361 atggagcaat ttcttatcaa gtgggttggc tgattccatT CTTCTGTTAC CGACTTTTTG 421 ACTTCGTCCT CAGTTGCCTG GTTGCTATTA GTTCTCTCAC CTATTTGCCA AGAATCAAAG 481 AATATCTGGA TCAACTACCT GATTTTCCCT ACAAAGATGA CCTCCTGGCC TTGGACTCCA 541 GCTGCCTCCT GTTCATTGTT CTTGTGTTCT TTGCCTTATT CATCATTTTT AAGGCTTATC 601 TAATTAACTG TGTTTGGAAC TGCTATAAAT ACATCAACAA CCGAAACGTG CCGGAGATTG 661 CTGTGTACCC TGCCTTTGAA GCACCTCCTC AGTACGTTTT GCCAACCTAT GAAATGGCCG 721 TGAAAATGCC TGAAAAAGAA CCACCACCTC CTTACTTACC TGCCTGCCCA ACTTTCTTGT 781 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 841 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 901 GAAAGGACGA AACGATTTTA CCAGCGTGTT CTGCACGCGT TAAGTCgaca atcaacctct 961 ggattacaaa atttgtgaaa gatt