Transcript: Mouse NM_008640.2

Mus musculus lysosomal-associated protein transmembrane 4A (Laptm4a), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Laptm4a (17775)
Length:
2130
CDS:
653..1579

Additional Resources:

NCBI RefSeq record:
NM_008640.2
NBCI Gene record:
Laptm4a (17775)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008640.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110864 GTTGCCTGATTTCCCATACAA pLKO.1 1306 CDS 100% 5.625 7.875 N Laptm4a n/a
2 TRCN0000325404 GTTGCCTGATTTCCCATACAA pLKO_005 1306 CDS 100% 5.625 7.875 N Laptm4a n/a
3 TRCN0000059983 GCCGTCTCTGTTCTTATGTTT pLKO.1 1130 CDS 100% 5.625 4.500 N LAPTM4A n/a
4 TRCN0000299330 GCCGTCTCTGTTCTTATGTTT pLKO_005 1130 CDS 100% 5.625 4.500 N LAPTM4A n/a
5 TRCN0000110861 GCTGTCAACATTCAGTATGAA pLKO.1 1052 CDS 100% 5.625 4.500 N Laptm4a n/a
6 TRCN0000325401 GCTGTCAACATTCAGTATGAA pLKO_005 1052 CDS 100% 5.625 4.500 N Laptm4a n/a
7 TRCN0000110860 GCCTTGTCAATAAAGCCTATA pLKO.1 1589 3UTR 100% 10.800 7.560 N Laptm4a n/a
8 TRCN0000353978 GCCTTGTCAATAAAGCCTATA pLKO_005 1589 3UTR 100% 10.800 7.560 N Laptm4a n/a
9 TRCN0000110862 GCTTACCTAATCAATTGTGTT pLKO.1 1406 CDS 100% 4.950 3.465 N Laptm4a n/a
10 TRCN0000325462 GCTTACCTAATCAATTGTGTT pLKO_005 1406 CDS 100% 4.950 3.465 N Laptm4a n/a
11 TRCN0000110863 TCAGTATGAAGTCATTGGTAA pLKO.1 1063 CDS 100% 4.950 3.465 N Laptm4a n/a
12 TRCN0000325403 TCAGTATGAAGTCATTGGTAA pLKO_005 1063 CDS 100% 4.950 3.465 N Laptm4a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008640.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15676 pDONR223 0% 69.6% 73.7% None (many diffs) n/a
2 ccsbBroad304_15676 pLX_304 0% 69.6% 73.7% V5 (many diffs) n/a
3 TRCN0000475138 AACGATTTTACCAGCGTGTTCTGC pLX_317 52.2% 69.6% 73.7% V5 (many diffs) n/a
4 ccsbBroadEn_07479 pDONR223 100% 69.5% 73.3% None (many diffs) n/a
5 ccsbBroad304_07479 pLX_304 0% 69.5% 73.3% V5 (many diffs) n/a
6 TRCN0000466952 CGATTGCCGTTTTAGCATTAGGCG pLX_317 48.1% 69.5% 73.3% V5 (many diffs) n/a
Download CSV