Construct: ORF TRCN0000475143
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016505.1_s317c1
- Derived from:
- ccsbBroadEn_13133
- DNA Barcode:
- CCCGGAACGCCAAAAGGTGGATCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- OSCP1 (127700)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475143
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 127700 | OSCP1 | organic solute carrier part... | XM_011540681.3 | 85.2% | 85.1% | 1_153del;162G>T;1015A>G |
| 2 | human | 127700 | OSCP1 | organic solute carrier part... | XM_011540680.2 | 82.9% | 82.8% | 1_183del;192G>T;1045A>G |
| 3 | human | 127700 | OSCP1 | organic solute carrier part... | NM_145047.5 | 78.9% | 78.8% | 1_237del;246G>T;1099A>G |
| 4 | human | 127700 | OSCP1 | organic solute carrier part... | NM_001330493.1 | 76.9% | 76.8% | 1_267del;276G>T;1129A>G |
| 5 | human | 127700 | OSCP1 | organic solute carrier part... | XR_001736979.2 | 58.7% | (many diffs) | |
| 6 | human | 127700 | OSCP1 | organic solute carrier part... | XR_001736978.1 | 56.3% | (many diffs) | |
| 7 | human | 127700 | OSCP1 | organic solute carrier part... | XM_017000303.2 | 54.2% | 52.2% | (many diffs) |
| 8 | human | 127700 | OSCP1 | organic solute carrier part... | XM_005270462.2 | 52.8% | 50.8% | (many diffs) |
| 9 | human | 127700 | OSCP1 | organic solute carrier part... | NM_206837.3 | 33.3% | 27.3% | (many diffs) |
| 10 | human | 127700 | OSCP1 | organic solute carrier part... | XM_005270463.3 | 32.5% | 26.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 966
- ORF length:
- 900
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa acttaaccag gccagcatgg ataagctcta tgacctgatg accatggctt 121 tcaaatatca agtattgctg tgtccccgac ccaaggatgt gctgctggtc actttcaatc 181 acttggatac catcaaggga ttcatccgag actccccaac catcctgcag caagtggacg 241 agactttgcg gcagctgaca gaaatatatg gtggtctctc tgcaggggag ttccagctga 301 tccggcagac actcctcatc ttcttccaag acctgcacat ccgagtatcc atgtttctaa 361 aggacaaagt tcagaataat aacggtcgct ttgtgttgcc ggtgtccggg cctgttcctt 421 ggggaactga agttccagga ctcatcagaa tgttcaacaa caaaggtgaa gaagtgaaga 481 ggatagaatt caagcatggt ggaaactatg tccctgcacc caaagaaggt tcttttgaac 541 tttatggaga ccgagtcctG AAACTGGGAA CTAACATGTA CAGCGTGAAT CAGCCTGTGG 601 AAACTCATGT GTCTGGATCA TCAAAGAACT TAGCCTCATG GACCCAGGAA AGCATTGCTC 661 CAAACCCTCT TGCTAAAGAA GAGCTGAATT TCTTGGCCAG GCTGATGGGA GGGATGGAGA 721 TTAAGAAACC CAGTGGCCCT GAGCCCGGAT TCCGGTTGAA TCTCTTTACC ACCGATGAAG 781 AAGAGGAACA AGCAGCGCTA ACCAGGCCAG AAGAGTTATC CTATGAAGTT ATCAACATAC 841 AAGCCACCCA GGACCAGCAA CGGAGCGAGG AGCTGGCTCG AATCATGGGG GAGTTTGAGA 901 TCACGGAGCA GCCAAGGCTG AGCACCGGCA AAGGGGACGA TTTGCTCGCC ATGATGGATG 961 AGTTATACCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1021 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1081 CTTGGCTTTA TATATCTTGT GGAAAGGACG ACCCGGAACG CCAAAAGGTG GATCAACGCG 1141 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt