Transcript: Human XR_001736978.1

PREDICTED: Homo sapiens organic solute carrier partner 1 (OSCP1), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
OSCP1 (127700)
Length:
1593
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001736978.1
NBCI Gene record:
OSCP1 (127700)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001736978.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414281 AGAGTTATCCTATGAAGTTAT pLKO_005 1204 3UTR 100% 13.200 18.480 N OSCP1 n/a
2 TRCN0000130028 GATTCCGGTTGAATCTCTTTA pLKO.1 1140 3UTR 100% 1.320 1.848 N OSCP1 n/a
3 TRCN0000128684 CCGAGTATCCATGTTTCTAAA pLKO.1 659 3UTR 100% 13.200 10.560 N OSCP1 n/a
4 TRCN0000127562 CGCCATGATGGATGAGTTATA pLKO.1 1339 3UTR 100% 13.200 10.560 N OSCP1 n/a
5 TRCN0000128449 GTCTGGATCATCAAAGAACTT pLKO.1 1003 3UTR 100% 4.950 3.960 N OSCP1 n/a
6 TRCN0000414518 CAGCAAGTGGACGAGACTTTG pLKO_005 546 3UTR 100% 10.800 7.560 N OSCP1 n/a
7 TRCN0000421066 CTAACATGTACAGCGTGAATC pLKO_005 963 3UTR 100% 10.800 7.560 N OSCP1 n/a
8 TRCN0000127983 GAATGACATCATCTCCACCAT pLKO.1 263 3UTR 100% 2.640 1.848 N OSCP1 n/a
9 TRCN0000127622 CCAGAATGATGCTGCTAGTTT pLKO.1 1434 3UTR 100% 5.625 3.375 N OSCP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001736978.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13133 pDONR223 100% 56.3% None (many diffs) n/a
2 ccsbBroad304_13133 pLX_304 0% 56.3% V5 (many diffs) n/a
3 TRCN0000475143 CCCGGAACGCCAAAAGGTGGATCA pLX_317 45.3% 56.3% V5 (many diffs) n/a
Download CSV