Transcript: Human XM_017000303.2

PREDICTED: Homo sapiens organic solute carrier partner 1 (OSCP1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
OSCP1 (127700)
Length:
1315
CDS:
83..940

Additional Resources:

NCBI RefSeq record:
XM_017000303.2
NBCI Gene record:
OSCP1 (127700)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000303.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414281 AGAGTTATCCTATGAAGTTAT pLKO_005 926 CDS 100% 13.200 18.480 N OSCP1 n/a
2 TRCN0000128684 CCGAGTATCCATGTTTCTAAA pLKO.1 595 CDS 100% 13.200 10.560 N OSCP1 n/a
3 TRCN0000127562 CGCCATGATGGATGAGTTATA pLKO.1 1061 3UTR 100% 13.200 10.560 N OSCP1 n/a
4 TRCN0000128449 GTCTGGATCATCAAAGAACTT pLKO.1 865 CDS 100% 4.950 3.960 N OSCP1 n/a
5 TRCN0000414518 CAGCAAGTGGACGAGACTTTG pLKO_005 482 CDS 100% 10.800 7.560 N OSCP1 n/a
6 TRCN0000421066 CTAACATGTACAGCGTGAATC pLKO_005 825 CDS 100% 10.800 7.560 N OSCP1 n/a
7 TRCN0000127983 GAATGACATCATCTCCACCAT pLKO.1 199 CDS 100% 2.640 1.848 N OSCP1 n/a
8 TRCN0000127622 CCAGAATGATGCTGCTAGTTT pLKO.1 1156 3UTR 100% 5.625 3.375 N OSCP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000303.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13133 pDONR223 100% 54.2% 52.2% None (many diffs) n/a
2 ccsbBroad304_13133 pLX_304 0% 54.2% 52.2% V5 (many diffs) n/a
3 TRCN0000475143 CCCGGAACGCCAAAAGGTGGATCA pLX_317 45.3% 54.2% 52.2% V5 (many diffs) n/a
Download CSV