Construct: ORF TRCN0000475161
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017631.1_s317c1
- Derived from:
- ccsbBroadEn_02477
- DNA Barcode:
- CCCTTCGGCAGTTTGCATAGTTCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- COLEC10 (10584)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475161
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10584 | COLEC10 | collectin subfamily member 10 | NM_006438.5 | 100% | 100% | |
| 2 | human | 10584 | COLEC10 | collectin subfamily member 10 | NM_001324095.2 | 75% | 75% | 0_1ins207 |
| 3 | human | 10584 | COLEC10 | collectin subfamily member 10 | XM_005250756.3 | 75% | 75% | 0_1ins207 |
| 4 | mouse | 239447 | Colec10 | collectin sub-family member 10 | NM_173422.3 | 86.1% | 88.8% | (many diffs) |
| 5 | mouse | 239447 | Colec10 | collectin sub-family member 10 | XM_011245615.1 | 62.2% | 66% | (many diffs) |
| 6 | mouse | 239447 | Colec10 | collectin sub-family member 10 | XM_011245616.2 | 62.2% | 66% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 900
- ORF length:
- 831
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gaatggcttt gcatccttgc ttcgaagaaa ccaatttatc ctcctggtac 121 tatttctttt gcaaattcag agtctgggtc tggatattga tagccgtcct accgctgaag 181 tctgtgccac acacacaatt tcaccaggac ccaaaggaga tgatggtgaa aaaggagatc 241 caggagaaga gggaaagcat ggcaaagtgg gacgcatggg gccgaaagga attaaaggag 301 aactgggtga tatgggagat cagggcaata ttggcaagac tgggcccatt gggaagaagg 361 gtgacaaagg ggaaaaaggt ttgcttggaa tacctggaga aaaaggcaaa gcaggtactg 421 tctgtgattg tggaagatac cggaaatttg ttggacaact ggatattagt attgctcggc 481 tcaagacatc tatgAAGTTT GTCAAGAATG TGATAGCAGG GATTAGGGAA ACTGAAGAGA 541 AATTCTACTA CATCGTGCAG GAAGAGAAGA ACTACAGGGA ATCCCTAACC CACTGCAGGA 601 TTCGGGGTGG AATGCTAGCC ATGCCCAAGG ATGAAGCTGC CAACACACTC ATCGCTGACT 661 ATGTTGCCAA GAGTGGCTTC TTTCGGGTGT TCATTGGCGT GAATGACCTT GAAAGGGAGG 721 GACAGTACAT GTTCACAGAC AACACTCCAC TGCAGAACTA TAGCAACTGG AATGAGGGGG 781 AACCCAGCGA CCCCTATGGT CATGAGGACT GTGTGGAGAT GCTGAGCTCT GGCAGATGGA 841 ATGACACAGA GTGCCATCTT ACCATGTACT TTGTCTGTGA GTTCATCAAG AAGAAAAAGT 901 TGCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 961 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1021 TTTATATATC TTGTGGAAAG GACGACCCTT CGGCAGTTTG CATAGTTCTA CGCGTTAAGT 1081 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt