Transcript: Human XM_005250756.3

PREDICTED: Homo sapiens collectin subfamily member 10 (COLEC10), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
COLEC10 (10584)
Length:
3096
CDS:
206..832

Additional Resources:

NCBI RefSeq record:
XM_005250756.3
NBCI Gene record:
COLEC10 (10584)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005250756.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000057359 CGGGTGTTCATTGGCGTGAAT pLKO.1 614 CDS 100% 4.950 6.930 N COLEC10 n/a
2 TRCN0000057361 GCAGGGATTAGGGAAACTGAA pLKO.1 446 CDS 100% 4.950 6.930 N COLEC10 n/a
3 TRCN0000371823 ATGGGAGATCAGGGCAATATT pLKO_005 242 CDS 100% 15.000 10.500 N COLEC10 n/a
4 TRCN0000371824 GGACAACTGGATATTAGTATT pLKO_005 383 CDS 100% 13.200 9.240 N COLEC10 n/a
5 TRCN0000371822 TTGTGGAAGATACCGGAAATT pLKO_005 358 CDS 100% 13.200 9.240 N COLEC10 n/a
6 TRCN0000057360 CCGAAAGGAATTAAAGGAGAA pLKO.1 212 CDS 100% 4.050 2.835 N COLEC10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005250756.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02477 pDONR223 100% 75% 75% None 0_1ins207 n/a
2 ccsbBroad304_02477 pLX_304 0% 75% 75% V5 0_1ins207 n/a
3 TRCN0000475161 CCCTTCGGCAGTTTGCATAGTTCT pLX_317 48.7% 75% 75% V5 0_1ins207 n/a
Download CSV