Transcript: Mouse XM_011245615.1

PREDICTED: Mus musculus collectin sub-family member 10 (Colec10), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Colec10 (239447)
Length:
4715
CDS:
374..964

Additional Resources:

NCBI RefSeq record:
XM_011245615.1
NBCI Gene record:
Colec10 (239447)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245615.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000067756 GCAATATGTGTTCACAGATAA pLKO.1 784 CDS 100% 13.200 18.480 N Colec10 n/a
2 TRCN0000067755 GTCTGGATGTTGATAGTCGAT pLKO.1 20 5UTR 100% 2.640 3.696 N Colec10 n/a
3 TRCN0000067754 GTGTCACCTTACCATGTATTT pLKO.1 913 CDS 100% 13.200 10.560 N Colec10 n/a
4 TRCN0000067753 CCGGGAAACTGAAGAGAAATT pLKO.1 586 CDS 100% 13.200 9.240 N Colec10 n/a
5 TRCN0000067757 GAGGAGAAGAACTACAGGGAA pLKO.1 623 CDS 100% 2.640 1.848 N Colec10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245615.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02477 pDONR223 100% 62.2% 66% None (many diffs) n/a
2 ccsbBroad304_02477 pLX_304 0% 62.2% 66% V5 (many diffs) n/a
3 TRCN0000475161 CCCTTCGGCAGTTTGCATAGTTCT pLX_317 48.7% 62.2% 66% V5 (many diffs) n/a
Download CSV