Construct: ORF TRCN0000475173
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013243.1_s317c1
- Derived from:
- ccsbBroadEn_12185
- DNA Barcode:
- CATTTCGCAATCGTACGGTTTGCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RCBTB1 (55213)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475173
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 55213 | RCBTB1 | RCC1 and BTB domain contain... | NM_001352505.2 | 99.6% | 99.4% | (many diffs) |
| 2 | human | 55213 | RCBTB1 | RCC1 and BTB domain contain... | XM_011535136.2 | 80.6% | 79.4% | (many diffs) |
| 3 | human | 55213 | RCBTB1 | RCC1 and BTB domain contain... | NM_001352504.1 | 72.3% | 71% | (many diffs) |
| 4 | human | 55213 | RCBTB1 | RCC1 and BTB domain contain... | NM_001352500.2 | 66.3% | 65.1% | (many diffs) |
| 5 | human | 55213 | RCBTB1 | RCC1 and BTB domain contain... | NM_001352501.2 | 66.3% | 65.1% | (many diffs) |
| 6 | human | 55213 | RCBTB1 | RCC1 and BTB domain contain... | NM_001352502.2 | 66.3% | 65.1% | (many diffs) |
| 7 | human | 55213 | RCBTB1 | RCC1 and BTB domain contain... | NM_001352503.2 | 66.3% | 65.1% | (many diffs) |
| 8 | human | 55213 | RCBTB1 | RCC1 and BTB domain contain... | NM_018191.4 | 66.3% | 65.1% | (many diffs) |
| 9 | human | 55213 | RCBTB1 | RCC1 and BTB domain contain... | XM_011535134.1 | 66.3% | 65.1% | (many diffs) |
| 10 | human | 55213 | RCBTB1 | RCC1 and BTB domain contain... | XR_245392.1 | 60.2% | (many diffs) | |
| 11 | human | 55213 | RCBTB1 | RCC1 and BTB domain contain... | XM_011535135.2 | 40.9% | 38.3% | (many diffs) |
| 12 | human | 55213 | RCBTB1 | RCC1 and BTB domain contain... | XR_001749596.1 | 32.2% | (many diffs) | |
| 13 | human | 55213 | RCBTB1 | RCC1 and BTB domain contain... | NM_001352506.2 | 30.1% | 29.1% | (many diffs) |
| 14 | human | 55213 | RCBTB1 | RCC1 and BTB domain contain... | NR_148016.2 | 25.6% | (many diffs) | |
| 15 | human | 55213 | RCBTB1 | RCC1 and BTB domain contain... | NR_148015.2 | 25.3% | (many diffs) | |
| 16 | human | 55213 | RCBTB1 | RCC1 and BTB domain contain... | XR_941613.1 | 16.7% | (many diffs) | |
| 17 | mouse | 71330 | Rcbtb1 | regulator of chromosome con... | NM_027764.2 | 58.4% | 61.3% | (many diffs) |
| 18 | mouse | 71330 | Rcbtb1 | regulator of chromosome con... | XM_006519566.2 | 58.4% | 61.3% | (many diffs) |
| 19 | mouse | 71330 | Rcbtb1 | regulator of chromosome con... | XM_006519567.2 | 58.4% | 61.3% | (many diffs) |
| 20 | mouse | 71330 | Rcbtb1 | regulator of chromosome con... | XM_006519568.2 | 58.4% | 61.3% | (many diffs) |
| 21 | mouse | 71330 | Rcbtb1 | regulator of chromosome con... | XM_006519569.2 | 58.4% | 61.3% | (many diffs) |
| 22 | mouse | 71330 | Rcbtb1 | regulator of chromosome con... | XM_017316204.1 | 58.4% | 61.3% | (many diffs) |
| 23 | mouse | 71330 | Rcbtb1 | regulator of chromosome con... | XM_017316205.1 | 58.4% | 61.3% | (many diffs) |
| 24 | mouse | 71330 | Rcbtb1 | regulator of chromosome con... | XR_383211.3 | 23.4% | (many diffs) | |
| 25 | mouse | 71330 | Rcbtb1 | regulator of chromosome con... | XM_011245196.2 | 20.8% | 20.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1131
- ORF length:
- 1065
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggt ggatgtcgga aagtggccca tcttcactct actctcccct caagagatcg 121 cgtctattcg gaaggtgtgt gtcttcggca cctcagccag tgaagcactg tacgttactg 181 acaatgatga ggtctttgta tttggactga actatagtaa ctgtctagga actggagata 241 accagagtac acttgtaccc aaaaagctag aaggcttatg tggaaagaag attaaaagcc 301 tcagttacgg gagtggacca catgttcttc tcagcaccga agatggagtg gtttatgcct 361 ggggccacaa tggatatagc cagcttggga atgggacgac caaccaaggc attgctaccg 421 tccaggtctg taccaatctc ttgatcaagc aagtggtgga agtagcttgt ggctcacatc 481 attcaatggc tctggcagct gatggagagg tgtttgcttg gggttataac aactgtggcc 541 aagtgggatc aggttctaca gcaaatcaac caactcctcg aaaagttaca aactgtttac 601 atattaagag ggtagttggc attgcctgtg gtcagacttc atccatggct gttctggaca 661 atggcgaggt atatggctgg ggttacaatg gcaacggtca gctgggcttg ggaaacaatg 721 gCAACCAGCT GACCCCTGTG AGAGTGGCAG CTTTGCACAG CGTGTGTGTG AACCAGATTG 781 TCTGCGGTTA CGCACATACT CTAGCACTAA CAGATGAGGG CTTGCTGTAT GCCTGGGGAG 841 CTAACACATA TGGGCAGCTG GGAACTGGCA ATAAAAATAA CCTGCTAAGC CCAGCACACA 901 TCATGGTGGA GAAAGAAAGG GTGGTAGAGA TTGCAGCCTG TCACTCTGCC CACACGTCTG 961 CAGCCAAGAC GCAGGGTGGG CACGTGTACA TGTGGGGCCA GTGCCGGGGT CAGTCCGTGA 1021 TCCTCCCGCA CCTCACCCAC TTCTCCTGCA CCGACGACGT GTTTGCCTGC TTTGCCACTC 1081 CGGCCGTCTC GTGGCGCCTC CTGTCTGTGG TGAGTATTGT GATTGGAAAA TACCCAACTT 1141 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1201 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1261 CTTGTGGAAA GGACGACATT TCGCAATCGT ACGGTTTGCA ACGCGTTAAG TCgacaatca 1321 acctctggat tacaaaattt gtgaaagatt