Transcript: Human NM_001352502.2

Homo sapiens RCC1 and BTB domain containing protein 1 (RCBTB1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
RCBTB1 (55213)
Length:
3931
CDS:
160..1755

Additional Resources:

NCBI RefSeq record:
NM_001352502.2
NBCI Gene record:
RCBTB1 (55213)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001352502.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273616 CCTCAAGAGATCGCGTCTATT pLKO_005 202 CDS 100% 13.200 18.480 N RCBTB1 n/a
2 TRCN0000164162 CCAGTGAAGCACTGTACGTTA pLKO.1 251 CDS 100% 4.950 6.930 N RCBTB1 n/a
3 TRCN0000161872 GCACTGTACGTTACTGACAAT pLKO.1 259 CDS 100% 4.950 6.930 N RCBTB1 n/a
4 TRCN0000273615 GCACTGTACGTTACTGACAAT pLKO_005 259 CDS 100% 4.950 6.930 N RCBTB1 n/a
5 TRCN0000159891 GCTGAAATAGATACAAGCCTA pLKO.1 3247 3UTR 100% 2.640 2.112 N RCBTB1 n/a
6 TRCN0000273669 CCTTACTGTGAAGGAATAATT pLKO_005 2241 3UTR 100% 15.000 10.500 N RCBTB1 n/a
7 TRCN0000163997 CTGGACAATGGCGAGGTATAT pLKO.1 748 CDS 100% 13.200 9.240 N RCBTB1 n/a
8 TRCN0000273614 CTGGACAATGGCGAGGTATAT pLKO_005 748 CDS 100% 13.200 9.240 N RCBTB1 n/a
9 TRCN0000159424 GCTTATGTGGAAAGAAGATTA pLKO.1 368 CDS 100% 13.200 9.240 N RCBTB1 n/a
10 TRCN0000273671 GCTTATGTGGAAAGAAGATTA pLKO_005 368 CDS 100% 13.200 9.240 N RCBTB1 n/a
11 TRCN0000164525 CCAGGTCTGTACCAATCTCTT pLKO.1 516 CDS 100% 4.950 3.465 N RCBTB1 n/a
12 TRCN0000159164 GAAGACATGAAGGAAGTGATA pLKO.1 1372 CDS 100% 4.950 3.465 N RCBTB1 n/a
13 TRCN0000160987 GCCAAATTACAAGTGGGTGAA pLKO.1 3130 3UTR 100% 4.050 2.835 N RCBTB1 n/a
14 TRCN0000110071 GCCAGTAAATGTGGAGCCTTT pLKO.1 1726 CDS 100% 4.050 2.835 N Rcbtb1 n/a
15 TRCN0000164016 CCAGAGTACACTTGTACCCAA pLKO.1 336 CDS 100% 2.640 1.848 N RCBTB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001352502.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12185 pDONR223 100% 66.3% 65.1% None (many diffs) n/a
2 ccsbBroad304_12185 pLX_304 0% 66.3% 65.1% V5 (many diffs) n/a
3 TRCN0000475173 CATTTCGCAATCGTACGGTTTGCA pLX_317 38.7% 66.3% 65.1% V5 (many diffs) n/a
Download CSV