Transcript: Mouse XM_017316205.1

PREDICTED: Mus musculus regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1 (Rcbtb1), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rcbtb1 (71330)
Length:
4103
CDS:
600..2195

Additional Resources:

NCBI RefSeq record:
XM_017316205.1
NBCI Gene record:
Rcbtb1 (71330)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316205.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295666 TGCGGTGATCTGCAGGTAAAG pLKO_005 2242 3UTR 100% 10.800 15.120 N Rcbtb1 n/a
2 TRCN0000110071 GCCAGTAAATGTGGAGCCTTT pLKO.1 2166 CDS 100% 4.050 5.670 N Rcbtb1 n/a
3 TRCN0000110074 CGGAAAGTTACAAACTGTTTA pLKO.1 1113 CDS 100% 13.200 10.560 N Rcbtb1 n/a
4 TRCN0000306712 CGGAAAGTTACAAACTGTTTA pLKO_005 1113 CDS 100% 13.200 10.560 N Rcbtb1 n/a
5 TRCN0000295668 ACATCATCAAGCGAGGAATTA pLKO_005 1981 CDS 100% 13.200 9.240 N Rcbtb1 n/a
6 TRCN0000110072 CCTGTCCAAGTCTGTACTAAT pLKO.1 951 CDS 100% 13.200 9.240 N Rcbtb1 n/a
7 TRCN0000288338 CCTGTCCAAGTCTGTACTAAT pLKO_005 951 CDS 100% 13.200 9.240 N Rcbtb1 n/a
8 TRCN0000295667 CTGATCTAAAGTTTCGAATTG pLKO_005 1708 CDS 100% 10.800 7.560 N Rcbtb1 n/a
9 TRCN0000110070 CCCTTCTTACAGGACTCCATA pLKO.1 3122 3UTR 100% 4.950 2.970 N Rcbtb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316205.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12185 pDONR223 100% 58.4% 61.3% None (many diffs) n/a
2 ccsbBroad304_12185 pLX_304 0% 58.4% 61.3% V5 (many diffs) n/a
3 TRCN0000475173 CATTTCGCAATCGTACGGTTTGCA pLX_317 38.7% 58.4% 61.3% V5 (many diffs) n/a
Download CSV