Transcript: Human NM_001347713.1

Homo sapiens FRA10A associated CGG repeat 1 (FRA10AC1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-02-25
Taxon:
Homo sapiens (human)
Gene:
FRA10AC1 (118924)
Length:
3217
CDS:
319..1266

Additional Resources:

NCBI RefSeq record:
NM_001347713.1
NBCI Gene record:
FRA10AC1 (118924)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001347713.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000158815 GCATAGCAGATCTCAGTAAAT pLKO.1 749 CDS 100% 13.200 18.480 N FRA10AC1 n/a
2 TRCN0000163933 GCAGAATTGCTGGATAGGGAA pLKO.1 475 CDS 100% 2.640 3.696 N FRA10AC1 n/a
3 TRCN0000416017 AGACTTTCCTGTCCTTTAAAT pLKO_005 1449 3UTR 100% 15.000 10.500 N FRA10AC1 n/a
4 TRCN0000159795 GCCAAGAATGTTCCATTAAAT pLKO.1 950 CDS 100% 15.000 10.500 N FRA10AC1 n/a
5 TRCN0000267390 ATGGAAAGGTGGCCCATAAAC pLKO_005 446 CDS 100% 13.200 9.240 N Fra10ac1 n/a
6 TRCN0000158896 GAAGAGAAATGCACTTGTTAA pLKO.1 918 CDS 100% 13.200 9.240 N FRA10AC1 n/a
7 TRCN0000428976 GATTCCATTGTTCCTACATTT pLKO_005 1534 3UTR 100% 13.200 9.240 N FRA10AC1 n/a
8 TRCN0000433937 TGGAAGTTCATTAGTTCAATT pLKO_005 1426 3UTR 100% 13.200 9.240 N FRA10AC1 n/a
9 TRCN0000160246 CTGAAGATTCTCTACTTAGAA pLKO.1 1127 CDS 100% 5.625 3.938 N FRA10AC1 n/a
10 TRCN0000159265 GAGACTTGCTAAGAAATACTA pLKO.1 705 CDS 100% 5.625 3.938 N FRA10AC1 n/a
11 TRCN0000160544 CAAAGACATACAAAGTTCGTA pLKO.1 541 CDS 100% 3.000 2.100 N FRA10AC1 n/a
12 TRCN0000161430 GAAGATGACTTACTGCTCCAA pLKO.1 403 CDS 100% 2.640 1.848 N FRA10AC1 n/a
13 TRCN0000419167 CAAGACAGACTTGGATGTTAT pLKO_005 624 CDS 100% 13.200 7.920 N FRA10AC1 n/a
14 TRCN0000160670 CTTAGAAACTCTGATGAGGAA pLKO.1 1141 CDS 100% 2.640 1.584 N FRA10AC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347713.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09457 pDONR223 100% 99.5% 99.3% None (many diffs) n/a
2 ccsbBroad304_09457 pLX_304 0% 99.5% 99.3% V5 (many diffs) n/a
3 TRCN0000475218 CCCGCCGCGTGCGGAGCATTTTCT pLX_317 39.1% 99.5% 99.3% V5 (many diffs) n/a
Download CSV