Construct: ORF TRCN0000475228
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004001.1_s317c1
- Derived from:
- ccsbBroadEn_04465
- DNA Barcode:
- AAGCCTCAGTTCCTATAACTTGCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RERG (85004)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475228
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 85004 | RERG | RAS like estrogen regulated... | NM_032918.3 | 100% | 100% | |
2 | human | 85004 | RERG | RAS like estrogen regulated... | XM_017020121.2 | 93.7% | 85.2% | (many diffs) |
3 | human | 85004 | RERG | RAS like estrogen regulated... | NM_001190726.2 | 90.4% | 90.4% | 60_61ins57 |
4 | mouse | 232441 | Rerg | RAS-like, estrogen-regulate... | NM_001164212.1 | 88.1% | 98.4% | (many diffs) |
5 | mouse | 232441 | Rerg | RAS-like, estrogen-regulate... | NM_181988.2 | 88.1% | 98.4% | (many diffs) |
6 | mouse | 232441 | Rerg | RAS-like, estrogen-regulate... | NM_001164214.1 | 79.3% | 89.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 663
- ORF length:
- 597
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc taaaagtgcg gaggtcaaac tggcaatatt tgggagagca ggcgtgggca 121 agtcagctct tgtagtgaga tttctgacca aacggttcat ctgggaatat gatcccaccc 181 tcgaatcaac ctaccgacac caagcaacca tcgatgatga agttgtttcc atggagatac 241 tagacactgc tggtcaggaa gataccattc agagggaggg gcacatgcga tggggggaag 301 gctttgtgct ggtctacgac attactgacc gaggaagttt tgaggaagtg ctgccactta 361 agaacatcct agatgagatc aaaaagccca agaatgtgac tctcatcttg gttggaaaca 421 aagctgactt ggaccactcc aggcaggtta gcacagaaga aggagagaag ctggCCACAG 481 AATTGGCTTG TGCTTTTTAC GAGTGCTCTG CCTGCACTGG AGAAGGGAAC ATCACAGAGA 541 TATTCTATGA ATTGTGTCGA GAGGTGCGTC GCCGGAGGAT GGTGCAGGGC AAGACGAGGC 601 GACGCAGCTC CACCACGCAT GTCAAGCAAG CCATTAACAA GATGCTCACC AAAATCAGTA 661 GTTATCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 721 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 781 GGCTTTATAT ATCTTGTGGA AAGGACGAAA GCCTCAGTTC CTATAACTTG CGACGCGTTA 841 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt