Transcript: Mouse NM_181988.2

Mus musculus RAS-like, estrogen-regulated, growth-inhibitor (Rerg), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rerg (232441)
Length:
2074
CDS:
167..766

Additional Resources:

NCBI RefSeq record:
NM_181988.2
NBCI Gene record:
Rerg (232441)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_181988.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102691 CCGCTGAAGAACATCTTAGAT pLKO.1 455 CDS 100% 5.625 4.500 N Rerg n/a
2 TRCN0000102694 CGTCAAGCAAGCGATTAACAA pLKO.1 721 CDS 100% 5.625 4.500 N Rerg n/a
3 TRCN0000047402 GTAGTGAGATTTCTGACCAAA pLKO.1 233 CDS 100% 4.950 3.960 N RERG n/a
4 TRCN0000102693 CCATAGACGATGAAGTTGTTT pLKO.1 309 CDS 100% 5.625 3.938 N Rerg n/a
5 TRCN0000102692 GCAACCATAGACGATGAAGTT pLKO.1 305 CDS 100% 4.950 3.465 N Rerg n/a
6 TRCN0000102690 GCTGGGAAATTCTCTGAGTAT pLKO.1 907 3UTR 100% 4.950 3.465 N Rerg n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181988.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04465 pDONR223 100% 88.1% 98.4% None (many diffs) n/a
2 ccsbBroad304_04465 pLX_304 0% 88.1% 98.4% V5 (many diffs) n/a
3 TRCN0000475228 AAGCCTCAGTTCCTATAACTTGCG pLX_317 32.2% 88.1% 98.4% V5 (many diffs) n/a
Download CSV