Transcript: Human XM_017020121.2

PREDICTED: Homo sapiens RAS like estrogen regulated growth inhibitor (RERG), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RERG (85004)
Length:
2378
CDS:
461..1051

Additional Resources:

NCBI RefSeq record:
XM_017020121.2
NBCI Gene record:
RERG (85004)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020121.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047401 CCACTTAAGAACATCCTAGAT pLKO.1 740 CDS 100% 4.950 6.930 N RERG n/a
2 TRCN0000047402 GTAGTGAGATTTCTGACCAAA pLKO.1 518 CDS 100% 4.950 6.930 N RERG n/a
3 TRCN0000047399 CCACAGAATTGGCTTGTGCTT pLKO.1 861 CDS 100% 2.640 3.696 N RERG n/a
4 TRCN0000047400 CGGTTCATCTGGGAATATGAT pLKO.1 539 CDS 100% 5.625 4.500 N RERG n/a
5 TRCN0000431021 ATTGTTTCTGGCCTCTAATAG pLKO_005 1171 3UTR 100% 13.200 9.240 N RERG n/a
6 TRCN0000412555 CATCGATGATGAAGTTGTTTC pLKO_005 595 CDS 100% 10.800 7.560 N RERG n/a
7 TRCN0000047398 CGCATGTCAAGCAAGCCATTA pLKO.1 1002 CDS 100% 10.800 7.560 N RERG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020121.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04465 pDONR223 100% 93.7% 85.2% None (many diffs) n/a
2 ccsbBroad304_04465 pLX_304 0% 93.7% 85.2% V5 (many diffs) n/a
3 TRCN0000475228 AAGCCTCAGTTCCTATAACTTGCG pLX_317 32.2% 93.7% 85.2% V5 (many diffs) n/a
Download CSV