Construct: ORF TRCN0000475330
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011533.1_s317c1
- Derived from:
- ccsbBroadEn_05259
- DNA Barcode:
- TTGTGATTCTAACTCACATCGGGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- C6orf89 (221477)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475330
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 221477 | C6orf89 | chromosome 6 open reading f... | NM_152734.4 | 100% | 100% | |
| 2 | human | 221477 | C6orf89 | chromosome 6 open reading f... | NM_001286635.2 | 98% | 98% | 0_1ins21 |
| 3 | human | 221477 | C6orf89 | chromosome 6 open reading f... | XM_011514377.3 | 98% | 98% | 0_1ins21 |
| 4 | human | 221477 | C6orf89 | chromosome 6 open reading f... | XM_017010432.2 | 98% | 98% | 0_1ins21 |
| 5 | human | 221477 | C6orf89 | chromosome 6 open reading f... | XM_017010433.2 | 98% | 98% | 0_1ins21 |
| 6 | human | 221477 | C6orf89 | chromosome 6 open reading f... | XM_017010434.2 | 98% | 98% | 0_1ins21 |
| 7 | human | 221477 | C6orf89 | chromosome 6 open reading f... | XM_024446354.1 | 98% | 98% | 0_1ins21 |
| 8 | human | 221477 | C6orf89 | chromosome 6 open reading f... | NM_001286636.2 | 68% | 68% | 0_1ins339 |
| 9 | human | 221477 | C6orf89 | chromosome 6 open reading f... | NM_001286637.2 | 68% | 68% | 0_1ins339 |
| 10 | mouse | 80748 | BC004004 | cDNA sequence BC004004 | XM_006525173.2 | 84.7% | 83.3% | (many diffs) |
| 11 | mouse | 80748 | BC004004 | cDNA sequence BC004004 | NM_030561.3 | 83.2% | 81.6% | (many diffs) |
| 12 | mouse | 80748 | BC004004 | cDNA sequence BC004004 | XM_006525174.3 | 83.2% | 81.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1131
- ORF length:
- 1062
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggattttata ttggaagaca tggatcttgc tgccaacgag atcagcattt 121 atgacaaact ttcagagact gttgatttgg tgagacagac cggccatcag tgtggcatgt 181 cagagaaggc aattgaaaaa tttatcagac agctgctgga aaagaatgaa cctcagagac 241 cccccccgca gtatcctctc cttatagttg tgtataaggt tctcgcaacc ttgggattaa 301 tcttgctcac tgcctacttt gtgattcaac ctttcagccc attagcacct gagccagtgc 361 tttctggagc tcacacctgg cgctcactca tccatcacat taggctgatg tccttgccca 421 ttgccaagaa gtacatgtca gaaaataagg gagttcctct gcatgggggt gatgaagaca 481 gaccctttcc agactttgac ccctggtgga caaacgactg tgagcagaat gagtcagagc 541 ccattcctgc caactgcact ggctgtgccc agaaacacct gaaggtgatg ctcctggaag 601 acgccccaag gaaatttgag aggctccatc cactggtgat caagacggga aagcccctgt 661 tggaggaaga gattcagcat tttttgtgcc agtaccctga ggcgacagaa ggcttctctg 721 aagggttttt cgccaagtgg tggcgctgct ttcctgagcg gtggttccca tttccttatc 781 catggaggag acctcTGAAC AGATCACAAA TGTTACGTGA GCTTTTTCCT GTTTTCACTC 841 ACCTGCCATT TCCAAAAGAT GCCTCTTTAA ACAAGTGCTC CTTTCTTCAC CCAGAACCTG 901 TTGTGGGGAG TAAGATGCAT AAGATGCCTG ACCTATTTAT CATTGGCAGC GGTGAGGCCA 961 TGTTGCAGCT CATCCCTCCC TTCCAGTGCC GAAGACATTG TCAGTCTGTG GCCATGCCAA 1021 TAGAGCCAGG GGATATCGGC TATGTCGACA CCACCCACTG GAAGGTCTAC GTTATAGCCA 1081 GAGGGGTCCA GCCTTTGGTC ATCTGCGATG GAACCGCTTT CTCAGAACTG TTGCCAACTT 1141 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1201 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1261 CTTGTGGAAA GGACGATTGT GATTCTAACT CACATCGGGT ACGCGTTAAG TCgacaatca 1321 acctctggat tacaaaattt gtgaaagatt