Transcript: Human XM_024446354.1

PREDICTED: Homo sapiens chromosome 6 open reading frame 89 (C6orf89), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C6orf89 (221477)
Length:
6796
CDS:
230..1273

Additional Resources:

NCBI RefSeq record:
XM_024446354.1
NBCI Gene record:
C6orf89 (221477)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446354.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139130 CCACTGGAAGGTCTACGTTAT pLKO.1 1195 CDS 100% 10.800 15.120 N C6orf89 n/a
2 TRCN0000144141 CACAAATGTTACGTGAGCTTT pLKO.1 945 CDS 100% 4.950 6.930 N C6orf89 n/a
3 TRCN0000140044 GACAAACGACTGTGAGCAGAA pLKO.1 649 CDS 100% 4.050 3.240 N C6orf89 n/a
4 TRCN0000144485 CATAAGATGCCTGACCTATTT pLKO.1 1058 CDS 100% 13.200 9.240 N C6orf89 n/a
5 TRCN0000140381 GACAGACCCTTTCCAGACTTT pLKO.1 617 CDS 100% 4.950 3.465 N C6orf89 n/a
6 TRCN0000138987 CAGAATGAGTCAGAGCCCATT pLKO.1 665 CDS 100% 4.050 2.835 N C6orf89 n/a
7 TRCN0000143588 GTTCCCATTTCCTTATCCATG pLKO.1 904 CDS 100% 4.050 2.835 N C6orf89 n/a
8 TRCN0000144529 CAGATCACAAATGTTACGTGA pLKO.1 940 CDS 100% 2.640 1.848 N C6orf89 n/a
9 TRCN0000143769 CATTTCCTTATCCATGGAGGA pLKO.1 909 CDS 100% 2.160 1.512 N C6orf89 n/a
10 TRCN0000122768 CCGAAGACATTGTCAGTCTGT pLKO.1 1129 CDS 100% 2.640 1.584 N C6orf89 n/a
11 TRCN0000140615 GAAACACCTGAAGGTGATGCT pLKO.1 712 CDS 100% 2.640 1.584 N C6orf89 n/a
12 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 4141 3UTR 100% 4.050 2.025 Y P3H4 n/a
13 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 4141 3UTR 100% 4.050 2.025 Y ORAI2 n/a
14 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 4141 3UTR 100% 4.050 2.025 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446354.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05259 pDONR223 100% 98% 98% None 0_1ins21 n/a
2 ccsbBroad304_05259 pLX_304 0% 98% 98% V5 0_1ins21 n/a
3 TRCN0000475330 TTGTGATTCTAACTCACATCGGGT pLX_317 31.8% 98% 98% V5 0_1ins21 n/a
Download CSV