Transcript: Mouse NM_030561.3

Mus musculus cDNA sequence BC004004 (BC004004), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
BC004004 (80748)
Length:
2809
CDS:
326..1372

Additional Resources:

NCBI RefSeq record:
NM_030561.3
NBCI Gene record:
BC004004 (80748)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_030561.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249477 CTCTCCTTATAGCCGTGTATA pLKO_005 492 CDS 100% 13.200 18.480 N BC004004 n/a
2 TRCN0000202177 CCTCTCCTTATAGCCGTGTAT pLKO.1 491 CDS 100% 4.950 6.930 N BC004004 n/a
3 TRCN0000249475 GCCCATTACCAAGAAGTATAT pLKO_005 652 CDS 100% 13.200 10.560 N BC004004 n/a
4 TRCN0000191027 CTACTTTGTAATTCAGCCTTT pLKO.1 550 CDS 100% 4.050 3.240 N BC004004 n/a
5 TRCN0000249473 ACTGGCTGTGCCCAGATATTA pLKO_005 794 CDS 100% 15.000 10.500 N BC004004 n/a
6 TRCN0000249474 CCATGGAGAAGACCTCTAAAC pLKO_005 1019 CDS 100% 10.800 7.560 N BC004004 n/a
7 TRCN0000249476 GCAAGGTGAGATATTGGTTTA pLKO_005 2553 3UTR 100% 10.800 7.560 N BC004004 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030561.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05259 pDONR223 100% 83.2% 81.6% None (many diffs) n/a
2 ccsbBroad304_05259 pLX_304 0% 83.2% 81.6% V5 (many diffs) n/a
3 TRCN0000475330 TTGTGATTCTAACTCACATCGGGT pLX_317 31.8% 83.2% 81.6% V5 (many diffs) n/a
Download CSV