Construct: ORF TRCN0000475353
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010915.1_s317c1
- Derived from:
- ccsbBroadEn_04359
- DNA Barcode:
- CTGCGTCGTTATTCGCTGTAGCAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ING5 (84289)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475353
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 84289 | ING5 | inhibitor of growth family ... | NM_032329.6 | 100% | 100% | |
| 2 | human | 84289 | ING5 | inhibitor of growth family ... | NM_001330162.2 | 94.1% | 94.1% | 678_679ins42 |
| 3 | human | 84289 | ING5 | inhibitor of growth family ... | XM_017005102.2 | 78.2% | 71.6% | (many diffs) |
| 4 | human | 84289 | ING5 | inhibitor of growth family ... | XM_017005097.1 | 78.1% | 75.6% | (many diffs) |
| 5 | human | 84289 | ING5 | inhibitor of growth family ... | XM_017005101.1 | 75.3% | 66.5% | (many diffs) |
| 6 | human | 84289 | ING5 | inhibitor of growth family ... | XM_017005098.1 | 73.4% | 71% | (many diffs) |
| 7 | human | 84289 | ING5 | inhibitor of growth family ... | XM_017005099.1 | 73.4% | 71% | (many diffs) |
| 8 | human | 84289 | ING5 | inhibitor of growth family ... | NM_001330161.2 | 72.8% | 57.5% | (many diffs) |
| 9 | human | 84289 | ING5 | inhibitor of growth family ... | XR_002959351.1 | 12.4% | (many diffs) | |
| 10 | human | 84289 | ING5 | inhibitor of growth family ... | XR_427115.4 | 10.6% | 1_20del;502_2086del;2326_6778del | |
| 11 | human | 84289 | ING5 | inhibitor of growth family ... | XR_001738993.2 | 9.4% | (many diffs) | |
| 12 | mouse | 66262 | Ing5 | inhibitor of growth family,... | NM_025454.2 | 88.4% | 94.5% | (many diffs) |
| 13 | mouse | 66262 | Ing5 | inhibitor of growth family,... | XM_006529792.3 | 88% | 93.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 786
- ORF length:
- 720
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gaccgccatg tacttggagc actatctgga cagtatcgag aaccttccct 121 gcgaacttca gaggaacttc cagctgatgc gagagctgga ccagaggacg gaagataaga 181 aagcagagat tgacatcctg gctgcagagt acatctccac ggtgaagacg ctgtctccag 241 accagcgcgt ggagcgcctg cagaagatcc agaacgccta cagcaagtgc aaggaataca 301 gtgacgacaa agtgcagctg gccatgcaga cctacgagat ggtggataaa cacattcgaa 361 ggcttgatgc agacctggcg cgctttGAAG CAGATCTGAA GGACAAGATG GAGGGCAGTG 421 ATTTTGAAAG CTCCGGAGGG CGAGGGTTAA AAAAAGGCCG GGGTCAGAAA GAAAAAAGAG 481 GGTCCCGGGG CCGAGGCAGG AGGACATCAG AGGAAGACAC ACCAAAGAAA AAGAAGCACA 541 AAGGAGGGTC TGAGTTCACT GACACCATCC TGTCCGTGCA CCCCTCTGAT GTGCTGGACA 601 TGCCCGTGGA CCCAAACGAA CCCACGTACT GCCTGTGCCA CCAGGTCTCC TATGGGGAGA 661 TGATTGGCTG TGACAATCCA GACTGTCCAA TTGAGTGGTT TCACTTTGCC TGCGTGGACC 721 TTACCACGAA ACCCAAAGGA AAATGGTTCT GTCCACGGTG TGTCCAGGAA AAGAGGAAGA 781 AGAAGTACCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 841 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 901 CTTGGCTTTA TATATCTTGT GGAAAGGACG ACTGCGTCGT TATTCGCTGT AGCACACGCG 961 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt