Transcript: Human NM_032329.6

Homo sapiens inhibitor of growth family member 5 (ING5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
ING5 (84289)
Length:
5197
CDS:
28..750

Additional Resources:

NCBI RefSeq record:
NM_032329.6
NBCI Gene record:
ING5 (84289)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032329.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358819 GGATCCGAGGAGCAAGTTAAT pLKO_005 767 3UTR 100% 13.200 18.480 N ING5 n/a
2 TRCN0000358877 CTTCATTCGTGTCGCAATATT pLKO_005 794 3UTR 100% 15.000 10.500 N ING5 n/a
3 TRCN0000358817 GGACCAGAGGACGGAAGATAA pLKO_005 120 CDS 100% 13.200 9.240 N ING5 n/a
4 TRCN0000367917 AGGAATACAGTGACGACAAAG pLKO_005 254 CDS 100% 10.800 7.560 N ING5 n/a
5 TRCN0000020092 GCGCTTTGAAGCAGATCTGAA pLKO.1 342 CDS 100% 4.950 3.465 N ING5 n/a
6 TRCN0000020090 CAAGGAATACAGTGACGACAA pLKO.1 252 CDS 100% 4.050 2.835 N ING5 n/a
7 TRCN0000020091 CTGGACAGTATCGAGAACCTT pLKO.1 58 CDS 100% 3.000 2.100 N ING5 n/a
8 TRCN0000020093 GTCTGAGTTCACTGACACCAT pLKO.1 510 CDS 100% 2.640 1.848 N ING5 n/a
9 TRCN0000020089 GAAGATAAGAAAGCAGAGATT pLKO.1 133 CDS 100% 4.950 2.970 N ING5 n/a
10 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 2700 3UTR 100% 4.950 2.475 Y n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032329.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04359 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04359 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475353 CTGCGTCGTTATTCGCTGTAGCAC pLX_317 55.4% 100% 100% V5 n/a
4 ccsbBroadEn_12802 pDONR223 100% 94.1% 94.1% None 679_720del n/a
5 ccsbBroad304_12802 pLX_304 0% 94.1% 94.1% V5 679_720del n/a
6 TRCN0000465573 TCTGCAGTTCTGCTGTCACCGCTA pLX_317 60.4% 94.1% 94.1% V5 679_720del n/a
Download CSV