Construct: ORF TRCN0000475377
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011127.1_s317c1
- Derived from:
- ccsbBroadEn_07060
- DNA Barcode:
- TTGCGGAGTCCTTACTGGAAGTCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TGIF1 (7050)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475377
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7050 | TGIF1 | TGFB induced factor homeobox 1 | NM_173207.4 | 69.6% | 67% | (many diffs) |
| 2 | human | 7050 | TGIF1 | TGFB induced factor homeobox 1 | NM_001278682.2 | 68.1% | 66% | (many diffs) |
| 3 | human | 7050 | TGIF1 | TGFB induced factor homeobox 1 | NM_001278684.2 | 67.3% | 66.5% | (many diffs) |
| 4 | human | 7050 | TGIF1 | TGFB induced factor homeobox 1 | NM_003244.4 | 67.3% | 66.5% | (many diffs) |
| 5 | human | 7050 | TGIF1 | TGFB induced factor homeobox 1 | NM_173208.3 | 67.3% | 66.5% | (many diffs) |
| 6 | human | 7050 | TGIF1 | TGFB induced factor homeobox 1 | XM_017025958.1 | 67.3% | 66.5% | (many diffs) |
| 7 | human | 7050 | TGIF1 | TGFB induced factor homeobox 1 | NM_001278686.2 | 62.7% | 62.5% | 0_1ins447;743C>T |
| 8 | human | 7050 | TGIF1 | TGFB induced factor homeobox 1 | NM_001374396.1 | 62.7% | 62.5% | 0_1ins447;743C>T |
| 9 | human | 7050 | TGIF1 | TGFB induced factor homeobox 1 | NM_001374397.1 | 62.7% | 62.5% | 0_1ins447;743C>T |
| 10 | human | 7050 | TGIF1 | TGFB induced factor homeobox 1 | NM_170695.5 | 62.7% | 62.5% | 0_1ins447;743C>T |
| 11 | human | 7050 | TGIF1 | TGFB induced factor homeobox 1 | NM_173209.3 | 62.7% | 62.5% | 0_1ins447;743C>T |
| 12 | human | 7050 | TGIF1 | TGFB induced factor homeobox 1 | NM_173210.4 | 62.7% | 62.5% | 0_1ins447;743C>T |
| 13 | human | 7050 | TGIF1 | TGFB induced factor homeobox 1 | NM_173211.2 | 62.7% | 62.5% | 0_1ins447;743C>T |
| 14 | human | 7050 | TGIF1 | TGFB induced factor homeobox 1 | NM_174886.3 | 62.7% | 62.5% | 0_1ins447;743C>T |
| 15 | mouse | 21815 | Tgif1 | TGFB-induced factor homeobox 1 | NM_001164075.1 | 64% | 60% | (many diffs) |
| 16 | mouse | 21815 | Tgif1 | TGFB-induced factor homeobox 1 | XM_011246363.2 | 60% | 58.9% | (many diffs) |
| 17 | mouse | 21815 | Tgif1 | TGFB-induced factor homeobox 1 | NM_009372.3 | 59.1% | 59.8% | (many diffs) |
| 18 | mouse | 21815 | Tgif1 | TGFB-induced factor homeobox 1 | XM_006524031.3 | 58.3% | 59.8% | (many diffs) |
| 19 | mouse | 21815 | Tgif1 | TGFB-induced factor homeobox 1 | NM_001164074.1 | 54.8% | 56.6% | (many diffs) |
| 20 | mouse | 21815 | Tgif1 | TGFB-induced factor homeobox 1 | NM_001164076.1 | 54.8% | 56.6% | (many diffs) |
| 21 | mouse | 21815 | Tgif1 | TGFB-induced factor homeobox 1 | NM_001164077.1 | 54.8% | 56.6% | (many diffs) |
| 22 | mouse | 21815 | Tgif1 | TGFB-induced factor homeobox 1 | XM_006524032.2 | 54.8% | 56.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1269
- ORF length:
- 1203
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggt tctagcgcag agccgggtgt ctgccggggt gggctccccg cattgttcgg 121 gctccggcgg gggcggctct gattcctttc catggcccgc ctcccacccc gggaatccgc 181 agtgctcctt ttccacggct tttctggcgt ccccccgact ctcccgcggc actttggcct 241 accttccccc agcgccgtgg tcctccctgg cgaccccctc tgcgctcctg gggtcctcct 301 gcgccccccc tcctccaccg gcgcgctgcc cacagccgcg tgccctctcc caggagctgg 361 ggaccaaggc tgggccccgc cggccgcatc ggtgggaact tccgcggtcc ccatcccagg 421 gcgcacaggg tccagctcct cggcgccgac tcctggaaac aatgaaaggt attgttgcag 481 catctggcag tgagactgag gatgaggaca gcatggacat tcccttggac ctttcttcat 541 ccgctggctc aggcaagaga aggagaaggg gcaacctacc caaggagtct gtgcagattc 601 ttcgggattg gctgtatgag caccgttaca atgcctatcc ttcagagcaa gaaaaagcgt 661 tgctgtccca gcaaacacac ctgtctacgc tacaggtctg taactggttc atcaacgccc 721 gccgcaggct cctccctgac atgctgagaa aggatggcaa agatccaaat cagttcacaa 781 tttcccgccg tggggccaag atttctgaaa cgagctctgt ggagtccgtg atgggcatca 841 aaaacttcat gccagctcta gaggagaccc catttcattc ctgtacagct gggccaaacc 901 caaccctagg gaggccactg tctcctaagc cgtcatcccc gggatcagtt ttggctcgtc 961 catcagtgat ctgccatacc actgtgactg cattgaaaga tgtccctttc tctctctgcc 1021 agtcggtcgg tgtgggacaa aacacagata tacagcagat agcggccaaa aacttcacag 1081 acacctctct catgtaccca gaggacactt gtAAATCTGG ACCAAGTACG AATACACAGA 1141 GTGGTCTTTT CAACACTCCT CCCCCTACTC CACCGGACCT CAACCAGGAC TTCAGTGGAT 1201 TTCAGCTTCT AGTGGATGTT GCACTCAAAC GGGCTGCAGA GATGGAGCTT CAGGTAAAAC 1261 TTACAGCTTA CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 1321 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1381 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGATTGCGG AGTCCTTACT GGAAGTCGAC 1441 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt