Transcript: Mouse NM_009372.3

Mus musculus TGFB-induced factor homeobox 1 (Tgif1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Tgif1 (21815)
Length:
1634
CDS:
324..1142

Additional Resources:

NCBI RefSeq record:
NM_009372.3
NBCI Gene record:
Tgif1 (21815)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009372.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233981 TAGTGGATGTTGCACTCAAAC pLKO_005 1081 CDS 100% 10.800 15.120 N Tgif1 n/a
2 TRCN0000055048 CCATTTCATTCCTGCGTAGTT pLKO.1 741 CDS 100% 4.950 6.930 N Tgif1 n/a
3 TRCN0000218560 GATGGCAAGAGATGCATTATT pLKO_005 1196 3UTR 100% 15.000 10.500 N Tgif1 n/a
4 TRCN0000233980 AGTACAGATGTACCGCAAATA pLKO_005 912 CDS 100% 13.200 9.240 N Tgif1 n/a
5 TRCN0000233979 ATTTCAGAAGCTAGCTCTATT pLKO_005 672 CDS 100% 13.200 9.240 N Tgif1 n/a
6 TRCN0000217978 CGAATGTTTCTTGGTAGTTTC pLKO_005 1353 3UTR 100% 10.800 7.560 N Tgif1 n/a
7 TRCN0000055050 GATCCAAATCAGTTCACGATT pLKO.1 633 CDS 100% 4.950 3.465 N Tgif1 n/a
8 TRCN0000055052 AGAGTACAGATGTACCGCAAA pLKO.1 910 CDS 100% 4.050 2.835 N Tgif1 n/a
9 TRCN0000055049 GAACACAGATACAACGCCTAT pLKO.1 489 CDS 100% 4.050 2.835 N Tgif1 n/a
10 TRCN0000055051 CTAGTGGATGTTGCACTCAAA pLKO.1 1080 CDS 100% 0.000 0.000 N Tgif1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009372.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01667 pDONR223 100% 87.6% 89.7% None (many diffs) n/a
2 ccsbBroad304_01667 pLX_304 0% 87.6% 89.7% V5 (many diffs) n/a
3 TRCN0000478988 TCCCTAATTGAACATCCTTTGCGT pLX_317 56.6% 87.6% 89.7% V5 (many diffs) n/a
4 ccsbBroadEn_07060 pDONR223 100% 59.1% 59.8% None (many diffs) n/a
5 ccsbBroad304_07060 pLX_304 0% 59.1% 59.8% V5 (many diffs) n/a
6 TRCN0000475377 TTGCGGAGTCCTTACTGGAAGTCG pLX_317 13.6% 59.1% 59.8% V5 (many diffs) n/a
Download CSV