Transcript: Human NM_170695.5

Homo sapiens TGFB induced factor homeobox 1 (TGIF1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
TGIF1 (7050)
Length:
3631
CDS:
835..1593

Additional Resources:

NCBI RefSeq record:
NM_170695.5
NBCI Gene record:
TGIF1 (7050)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_170695.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000020153 CGAATACACAGAGTGGTCTTT pLKO.1 1451 CDS 100% 4.950 6.930 N TGIF1 n/a
2 TRCN0000020151 CTTGTAAATCTGGACCAAGTA pLKO.1 1430 CDS 100% 4.950 3.960 N TGIF1 n/a
3 TRCN0000020149 GCAAGAGATGAATTGCATTAT pLKO.1 1646 3UTR 100% 13.200 9.240 N TGIF1 n/a
4 TRCN0000233981 TAGTGGATGTTGCACTCAAAC pLKO_005 1532 CDS 100% 10.800 7.560 N Tgif1 n/a
5 TRCN0000020152 CCCAGCAAACACACCTGTCTA pLKO.1 989 CDS 100% 4.950 3.465 N TGIF1 n/a
6 TRCN0000020150 CTGTGCAGATTCTTCGGGATT pLKO.1 911 CDS 100% 4.050 2.835 N TGIF1 n/a
7 TRCN0000055051 CTAGTGGATGTTGCACTCAAA pLKO.1 1531 CDS 100% 0.000 0.000 N Tgif1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_170695.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01667 pDONR223 100% 92.6% 92.6% None 0_1ins60 n/a
2 ccsbBroad304_01667 pLX_304 0% 92.6% 92.6% V5 0_1ins60 n/a
3 TRCN0000478988 TCCCTAATTGAACATCCTTTGCGT pLX_317 56.6% 92.6% 92.6% V5 0_1ins60 n/a
4 ccsbBroadEn_07060 pDONR223 100% 62.7% 62.5% None 0_1ins447;743C>T n/a
5 ccsbBroad304_07060 pLX_304 0% 62.7% 62.5% V5 0_1ins447;743C>T n/a
6 TRCN0000475377 TTGCGGAGTCCTTACTGGAAGTCG pLX_317 13.6% 62.7% 62.5% V5 0_1ins447;743C>T n/a
Download CSV