Construct: ORF TRCN0000475394
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015064.1_s317c1
- Derived from:
- ccsbBroadEn_02503
- DNA Barcode:
- GTTATTTAGACCTAAACAGGGTCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TNFSF13B (10673)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475394
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 10673 | TNFSF13B | TNF superfamily member 13b | NM_006573.4 | 100% | 100% | |
2 | human | 10673 | TNFSF13B | TNF superfamily member 13b | NM_001145645.2 | 93.3% | 93.3% | 422_423ins57 |
3 | human | 10673 | TNFSF13B | TNF superfamily member 13b | XR_001749468.1 | 30.5% | 1_1656del;2138_2255del;2578_2579ins51 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 921
- ORF length:
- 855
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga tgactccaca gaaagggagc agtcacgcct tacttcttgc cttaagaaaa 121 gagaagaaat gaaactgaag gagtgtgttt ccatcctccc acggaaggaa agcccctctg 181 tccgatcctc caaagacgga aagctgctgg ctgcaacctt gctgctggca ctgctgtctt 241 gctgcctcac ggtggtgtct ttctaccagg tggccgccct gcaaggggac ctggccagcc 301 tccgggcaga gctgcagggc caccacgcgg agaagctgcc agcaggagca ggagccccca 361 aggccggcct ggaggaagct ccagctgtca ccgcgggact gaaaatcttt gaaccaccag 421 ctccaggaga aggcaactcc agtcagaaca gcagaaataa gcgtgccgtt cagggtccag 481 aagaaacagt cactcaagac tgcttgcaac tgattgcaga cagtgaaaca ccaactatac 541 aaaaaggatc ttacacattt gttccatggc ttctcagctt tAAAAGGGGA AGTGCCCTAG 601 AAGAAAAAGA GAATAAAATA TTGGTCAAAG AAACTGGTTA CTTTTTTATA TATGGTCAGG 661 TTTTATATAC TGATAAGACC TACGCCATGG GACATCTAAT TCAGAGGAAG AAGGTCCATG 721 TCTTTGGGGA TGAATTGAGT CTGGTGACTT TGTTTCGATG TATTCAAAAT ATGCCTGAAA 781 CACTACCCAA TAATTCCTGC TATTCAGCTG GCATTGCAAA ACTGGAAGAA GGAGATGAAC 841 TCCAACTTGC AATACCAAGA GAAAATGCAC AAATATCACT GGATGGAGAT GTCACATTTT 901 TTGGTGCATT GAAACTGCTG TGCCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 961 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1021 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAGTTA TTTAGACCTA 1081 AACAGGGTCG ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt