Transcript: Human XR_001749468.1

PREDICTED: Homo sapiens TNF superfamily member 13b (TNFSF13B), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TNFSF13B (10673)
Length:
2578
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001749468.1
NBCI Gene record:
TNFSF13B (10673)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001749468.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358890 CCTGAAACACTACCCAATAAT pLKO_005 2483 3UTR 100% 15.000 21.000 N TNFSF13B n/a
2 TRCN0000358825 CTACGCCATGGGACATCTAAT pLKO_005 2389 3UTR 100% 13.200 18.480 N TNFSF13B n/a
3 TRCN0000058549 CACGCCTTACTTCTTGCCTTA pLKO.1 1685 3UTR 100% 4.050 5.670 N TNFSF13B n/a
4 TRCN0000058550 GTGACTTTGTTTCGATGTATT pLKO.1 2453 3UTR 100% 13.200 10.560 N TNFSF13B n/a
5 TRCN0000358826 GACAGTGAAACACCAACTATA pLKO_005 2110 3UTR 100% 13.200 9.240 N TNFSF13B n/a
6 TRCN0000058551 AGACAGTGAAACACCAACTAT pLKO.1 2109 3UTR 100% 5.625 3.938 N TNFSF13B n/a
7 TRCN0000058552 CCAGAAGAAACAGTCACTCAA pLKO.1 2068 3UTR 100% 4.950 3.465 N TNFSF13B n/a
8 TRCN0000058548 CTACCCAATAATTCCTGCTAT pLKO.1 2492 3UTR 100% 4.950 3.465 N TNFSF13B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001749468.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02503 pDONR223 100% 30.5% None 1_1656del;2138_2255del;2578_2579ins51 n/a
2 ccsbBroad304_02503 pLX_304 0% 30.5% V5 1_1656del;2138_2255del;2578_2579ins51 n/a
3 TRCN0000475394 GTTATTTAGACCTAAACAGGGTCG pLX_317 40% 30.5% V5 1_1656del;2138_2255del;2578_2579ins51 n/a
Download CSV