Transcript: Human NM_001145645.2

Homo sapiens TNF superfamily member 13b (TNFSF13B), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
TNFSF13B (10673)
Length:
2618
CDS:
268..1068

Additional Resources:

NCBI RefSeq record:
NM_001145645.2
NBCI Gene record:
TNFSF13B (10673)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001145645.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358890 CCTGAAACACTACCCAATAAT pLKO_005 919 CDS 100% 15.000 21.000 N TNFSF13B n/a
2 TRCN0000358825 CTACGCCATGGGACATCTAAT pLKO_005 825 CDS 100% 13.200 18.480 N TNFSF13B n/a
3 TRCN0000058549 CACGCCTTACTTCTTGCCTTA pLKO.1 296 CDS 100% 4.050 5.670 N TNFSF13B n/a
4 TRCN0000058550 GTGACTTTGTTTCGATGTATT pLKO.1 889 CDS 100% 13.200 10.560 N TNFSF13B n/a
5 TRCN0000058548 CTACCCAATAATTCCTGCTAT pLKO.1 928 CDS 100% 4.950 3.465 N TNFSF13B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145645.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02503 pDONR223 100% 93.3% 93.3% None 422_423ins57 n/a
2 ccsbBroad304_02503 pLX_304 0% 93.3% 93.3% V5 422_423ins57 n/a
3 TRCN0000475394 GTTATTTAGACCTAAACAGGGTCG pLX_317 40% 93.3% 93.3% V5 422_423ins57 n/a
Download CSV